Background: Universities face rising budgetary constraints, usually leading to fewer funds to help microbiology laboratory. On-line actions mock labs usually instituted as an economical various to conventional moist labs for medical college students.Goal: The intention of this examine is to check the scholars’ perceptions of on-line and in-person studying experiences.Design microbiology lab: We examine the notion of undergraduate medical college students from in-person and on-line microbiology laboratory expertise; 164 first yr medical college students participated in a web-based lab newly designed, whereas 83 second-year medical college students proceed to make use of within the laboratory. A web-based survey is given what college students collect from expertise.

Sheep Amyloid Beta Peptide 1-42 (Ab1-42) ELISA Kit
abx364753-96tests	Abbexa	96 tests	EUR 1111.2
Shipped within 5-12 working days.

IA-1 Peptide
5415P	ProSci	0.05 mg	EUR 197.7
Description: (NT) IA-1 peptide

IA-6 Peptide
5417P	ProSci	0.05 mg	EUR 197.7
Description: (CT) IA-6 peptide

RXR beta Peptide
45-140P	ProSci	0.1 mg	EUR 405.6
Description: (IN) RXR beta Peptide

B56 beta Peptide
45-312P	ProSci	0.1 mg	EUR 405.6
Description: B56 beta Peptide

Il12 beta Peptide
45-766P	ProSci	0.1 mg	EUR 405.6
Description: Il12b / Il12p40 Peptide

Beta-actin Peptide
3777P	ProSci	0.05 mg	EUR 197.7
Description: (CT) Beta-actin peptide

Beta-actin Peptide
3779P	ProSci	0.05 mg	EUR 197.7
Description: (NT) Beta-actin peptide

beta Casomorphin Peptide
20-abx265093	Abbexa	EUR 427.2 EUR 644.4 EUR 343.2	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

beta Casomorphin Peptide
20-abx265429	Abbexa	EUR 427.2 EUR 644.4 EUR 343.2	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

IL-1 beta Peptide
43-610P	ProSci	0.1 mg	EUR 405.6

IKK beta (C3) Peptide
2121P	ProSci	0.05 mg	EUR 197.7
Description: (CT3) IKK beta (C3) peptide

beta Bag Cell Peptide
20-abx265792	Abbexa	EUR 393.6 EUR 594 EUR 326.4	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

beta I probe Peptide
20-abx266491	Abbexa	EUR 693.6 EUR 1195.2 EUR 493.2	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

beta Neuroprotectin Peptide
20-abx266216	Abbexa	EUR 560.4 EUR 910.8 EUR 410.4	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

beta-Galactosidase Peptide
5155P	ProSci	0.05 mg	EUR 197.7
Description: (NT) beta-Galactosidase peptide

beta-Bag Cell Peptide
5-00467	CHI Scientific	4 x 5mg	Ask for price

Stick sheet
2312212	Atto	4unit	EUR 295.2
Description: 2pcs

Integrin beta 5 Peptide
45-777P	ProSci	0.1 mg	EUR 405.6
Description: Integrin beta 5 Peptide

CG beta Blocking Peptide
20-abx062414	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

LT beta Blocking Peptide
20-abx162554	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

Salusin beta Peptide (OVA)
20-abx165597	Abbexa	EUR 693.6 EUR 309.6 EUR 2064 EUR 828 EUR 510	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

TCR beta Blocking Peptide
5651BP-50	Biovision	each	EUR 183.6

hCG beta Blocking Peptide
AF0177-BP	Affbiotech	1mg	EUR 234

RAR beta Blocking Peptide
20-abx063184	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

TCR beta Blocking Peptide
33R-10581	Fitzgerald	50 ug	EUR 418.8
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TCR beta antibody, catalog no. 20R-1838

TGF beta Blocking Peptide
33R-11047	Fitzgerald	50 ug	EUR 229.2
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TGF beta antibody, catalog no. 70R-12368

TCR beta Blocking Peptide
33R-11054	Fitzgerald	50 ug	EUR 229.2
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TCR beta antibody, catalog no. 70R-12401

IL1 beta Blocking Peptide
33R-2037	Fitzgerald	100 ug	EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IL1B antibody, catalog no. 70R-5695

IL1 beta Blocking Peptide
33R-5648	Fitzgerald	100 ug	EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IL1B antibody, catalog no. 70R-5694

NGF beta Blocking Peptide
20-abx061125	Abbexa	EUR 343.2 EUR 510	1 mg 5 mg
Shipped within 5-10 working days.

CK2 beta Blocking Peptide
20-abx062480	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

DGK beta Blocking Peptide
20-abx062525	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

IFN beta Blocking Peptide
20-abx062768	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

TNF beta Blocking Peptide
20-abx062891	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

IKK beta Blocking Peptide
20-abx063002	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

NGF beta Blocking Peptide
AF5172-BP	Affbiotech	1mg	EUR 234

PKC beta Blocking Peptide
20-abx161381	Abbexa	EUR 727.2 EUR 1713.6	1 mg 5 mg
Shipped within 5-10 working days.

IKK beta Blocking Peptide
20-abx161893	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

IKK beta Blocking Peptide
20-abx161894	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

FSH beta Blocking Peptide
20-abx162438	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

TCR beta Blocking Peptide
DF8621-BP	Affbiotech	1mg	EUR 234

CBF beta Blocking Peptide
DF3273-BP	Affbiotech	1mg	EUR 234

SDF1 beta Blocking Peptide
33R-11044	Fitzgerald	50 ug	EUR 229.2
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDF1 beta antibody, catalog no. 70R-12340

HNF1 beta Blocking Peptide
20-abx061843	Abbexa	EUR 309.6 EUR 460.8	1 mg 5 mg
Shipped within 5-10 working days.

GSK3 beta Blocking Peptide
AF7814-BP	Affbiotech	1mg	EUR 234

HNF1 beta Blocking Peptide
AF5394-BP	Affbiotech	1mg	EUR 234

GSK3 beta Blocking Peptide
AF5016-BP	Affbiotech	1mg	EUR 234

IDH3 beta Blocking Peptide
20-abx161135	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

HIF1 beta Blocking Peptide
20-abx161546	Abbexa	EUR 727.2 EUR 1713.6	1 mg 5 mg
Shipped within 5-10 working days.

GSK3 beta Blocking Peptide
20-abx162471	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

TIF1 beta Blocking Peptide
DF7531-BP	Affbiotech	1mg	EUR 234

Karyopherin beta 1 Peptide
45-791P	ProSci	0.1 mg	EUR 405.6
Description: Karyopherin Peptide

beta Actin Blocking Peptide
33R-9203	Fitzgerald	100 ug	EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACTB antibody, catalog no. 70R-2519

beta Actin Blocking Peptide
33R-10536	Fitzgerald	50 ug	EUR 418.8
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of beta Actin antibody, catalog no. 20R-1696

beta Actin Blocking Peptide
33R-10559	Fitzgerald	50 ug	EUR 418.8
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of beta Actin antibody, catalog no. 20R-1744

beta Actin Blocking Peptide
33R-10860	Fitzgerald	50 ug	EUR 229.2
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of beta Actin antibody, catalog no. 70R-11980

beta Actin Blocking Peptide
33R-7326	Fitzgerald	100 ug	EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACTB antibody, catalog no. 70R-2908

CaMKK beta Blocking Peptide
20-abx061337	Abbexa	EUR 343.2 EUR 510	1 mg 5 mg
Shipped within 5-10 working days.

CaMK2 beta Blocking Peptide
20-abx062321	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

PDGFR beta Blocking Peptide
20-abx063061	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

PDGFR beta Blocking Peptide
AF6132-BP	Affbiotech	1mg	EUR 234

PDGFR beta Blocking Peptide
AF6133-BP	Affbiotech	1mg	EUR 234

beta Actin Blocking Peptide
AF7018-BP	Affbiotech	1mg	EUR 234

HSP90 beta Blocking Peptide
BF9107-BP	Affbiotech	1mg	EUR 234

HSP90 beta Blocking Peptide
20-abx161643	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

MaxiK beta Blocking Peptide
DF8571-BP	Affbiotech	1mg	EUR 234

beta Casein (90-96) Peptide
20-abx265830	Abbexa	EUR 427.2 EUR 644.4 EUR 343.2	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

Human Amyloid Beta Peptide 1-40 (Ab1-40) Peptide
20-abx652283	Abbexa	EUR 376.8 EUR 243.6 EUR 927.6 EUR 410.4 EUR 309.6	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Amyloid Beta Peptide 1-40 (Ab1-40) Peptide
abx670346-1mg	Abbexa	1 mg	EUR 627.6
Shipped within 1 week.

Resistin-like beta Peptide
46-892P	ProSci	0.1 mg	EUR 405.6
Description: RELMbeta Peptide

Klotho Beta Blocking Peptide
33R-1868	Fitzgerald	100 ug	EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KLB antibody, catalog no. 70R-7053

GADD45 beta Blocking Peptide
20-abx064181	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

beta Neo-Endorphin Peptide
20-abx266131	Abbexa	EUR 493.2 EUR 794.4 EUR 376.8	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

beta Amyloid (32-35) Peptide
20-abx265735	Abbexa	EUR 393.6 EUR 594 EUR 326.4	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

beta Amyloid (31-35) Peptide
20-abx265759	Abbexa	EUR 393.6 EUR 594 EUR 326.4	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

beta Amyloid (17-21) Peptide
20-abx265783	Abbexa	EUR 393.6 EUR 594 EUR 326.4	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

beta Amyloid (16-20) Peptide
20-abx265795	Abbexa	EUR 393.6 EUR 594 EUR 326.4	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

beta Amyloid (15-21) Peptide
20-abx265883	Abbexa	EUR 427.2 EUR 644.4 EUR 343.2	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

beta Amyloid (16-23) Peptide
20-abx265994	Abbexa	EUR 460.8 EUR 710.4 EUR 360	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

beta Amyloid (12-20) Peptide
20-abx266143	Abbexa	EUR 493.2 EUR 794.4 EUR 376.8	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

beta Amyloid (25-35) Peptide
20-abx266223	Abbexa	EUR 560.4 EUR 910.8 EUR 410.4	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

beta Amyloid (35-25) Peptide
20-abx266224	Abbexa	EUR 560.4 EUR 910.8 EUR 410.4	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

beta Amyloid (18-28) Peptide
20-abx266239	Abbexa	EUR 560.4 EUR 910.8 EUR 410.4	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

beta Amyloid (16-26) Peptide
20-abx266242	Abbexa	EUR 560.4 EUR 910.8 EUR 410.4	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

beta Amyloid (10-20) Peptide
20-abx266263	Abbexa	EUR 560.4 EUR 910.8 EUR 410.4	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

beta Amyloid (11-22) Peptide
20-abx266325	Abbexa	EUR 594 EUR 978 EUR 427.2	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

Outcomes lab: When it comes to self-reported scholar’s studying type, college students who attend non-public labs have been extra prone to report a tactile studying type (33% vs 16%), whereas the scholars are studying the fabric on-line reporting preferences visible studying type (77% vs 61%; n = 264). College students really feel that the microbiology lab on-line is extra handy for his or her schedule when in comparison with in-person laboratory.

Most on-line college students (12%) felt that they meet the brand new materials on the finish of the quiz the scholars within the (1%; n = 245). Even so, 43% of scholars are educated on-line and 37% of the coed vote in an informed perceived lab expertise they’re assigned to be a design lab that’s optimum, and greater than 89% of each teams reported a need for no less than some in-person instruction within the setting.

wet-lab Conclusions: our findings recommend that, whereas the scholars are very supportive digital on-line lab actions, the vast majority of college students nonetheless reported a need for a mixture of on-line and in-person, hands-on lab actions.

These findings can be directed analysis college students’ perceptions of laboratory expertise and help in microbiology curriculum variations to accommodate each college students and the college wants.

E-learning can enhance the efficiency of graduate medical college students in Medical Microbiology examination?

Medical Microbiology is a core topic within the medical undergraduate curriculum. Nevertheless, college students wrestle to cowl the contents and scientific microbiology fundamental contextualization. Our goal is to judge the coed’s involvement with the brand new e-learning supplies and to research the influence on efficiency audit in Medical Microbiology module.

 

A web-based useful resource designed to help the didactic educating Fundamentals of Medical Microbiology module.

One group of scholars have entry to on-line materials (2017/2018 class) and others not (2016/2017 class). Every group sat collectively a number of selection query (MCQ) and a brief question-notes (SNQ) examination paper and the influence of engagement with the assets and efficiency checks on-line is identical group analysed.

Each tutorial requirements earlier than beginning the module. Within the 2017/2018 cohort, 227/309 (73.5%) college students had ≥80% engagement with the content material.

College students are concerned principally with indices of pathogens and pathogen centered scientific case associated to a spread of genera and households are clinically essential microorganisms. Increased statistical distinction within the common proportion of fine grade in MCQ and SNQ examination seems for 2017/2018 in contrast with 2016/2017 cohort. For the MCQ examination, the 2017/2018 cohort was on common 5:57% (95% confidence interval (CI): 3.92 to 7.24%; P <0.001) larger, and for the examination of the 2017/2018 SNQ cohort common of two.08% (95% CI: 0.74 to three.41%; P = 0.02) larger.

TCF25 Blocking Peptide
33R-3842	Fitzgerald	100 ug	EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TCF25 antibody, catalog no. 70R-8726

TCF25 Blocking Peptide
33R-8470	Fitzgerald	100 ug	EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TCF25 antibody, catalog no. 20R-1266

TCF23 Blocking Peptide
33R-7226	Fitzgerald	100 ug	EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TCF23 antibody, catalog no. 20R-1160

TCF19 Blocking Peptide
DF9971-BP	Affbiotech	1mg	EUR 234

TCF3 Blocking Peptide
20-abx063331	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

TCF7 Blocking Peptide
20-abx063332	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

TCF3 Blocking Peptide
33R-10627	Fitzgerald	50 ug	EUR 229.2
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TCF3 antibody, catalog no. 70R-11605

TCF3 Blocking Peptide
BF0632-BP	Affbiotech	1mg	EUR 234

TCF6 Blocking Peptide
20-abx162059	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

TCF7 Blocking Peptide
DF7179-BP	Affbiotech	1mg	EUR 234

TCF4 Blocking Peptide
DF6275-BP	Affbiotech	1mg	EUR 234

TCF2 Blocking Peptide
DF10056-BP	Affbiotech	1mg	EUR 234

TCF3 Blocking Peptide
DF3097-BP	Affbiotech	1mg	EUR 234

TCF7 Blocking Peptide
DF3168-BP	Affbiotech	1mg	EUR 234

Tcf7l2 Blocking Peptide
33R-10305	Fitzgerald	100 ug	EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Tcf7l2 antibody, catalog no. 70R-8381

TCF7L2 Blocking Peptide
DF7622-BP	Affbiotech	1mg	EUR 234

TCF7L1 Blocking Peptide
DF4573-BP	Affbiotech	1mg	EUR 234

TCF4 / 12 Blocking Peptide
20-abx161486	Abbexa	EUR 727.2 EUR 1713.6	1 mg 5 mg
Shipped within 5-10 working days.

TCF4/12 Blocking Peptide
DF4572-BP	Affbiotech	1mg	EUR 234

TCF3/E2A Blocking Peptide
3090BP-50	Biovision	each	EUR 183.6

TCF12/HEB (TCF12) Antibody
abx238552-100ug	Abbexa	100 ug	EUR 610.8
Shipped within 5-12 working days.

Tcfec Peptide
46-474P	ProSci	0.1 mg	EUR 405.6
Description: Tcfec Peptide

TCFL5 Peptide
46-475P	ProSci	0.1 mg	EUR 405.6
Description: CHA / TCFL5 Peptide

Tcf12/ Rat Tcf12 ELISA Kit
ELI-48272r	Lifescience Market	96 Tests	EUR 1063.2

Human TCF12/HEB (TCF12) ELISA Kit
abx259881-96tests	Abbexa	96 tests	EUR 1093.2
Shipped within 5-12 working days.

TCFL4 Blocking Peptide
20-abx063335	Abbexa	EUR 326.4 EUR 493.2	1 mg 5 mg
Shipped within 5-10 working days.

TCFL5 Blocking Peptide
20-abx061246	Abbexa	EUR 343.2 EUR 510	1 mg 5 mg
Shipped within 5-10 working days.

TCFL5 Blocking Peptide
AF9211-BP	Affbiotech	1mg	EUR 234

TCF12 siRNA
20-abx905499	Abbexa	EUR 661.2 EUR 878.4	15 nmol 30 nmol
Shipped within 5-10 working days.

TCF12 siRNA
20-abx936325	Abbexa	EUR 661.2 EUR 878.4	15 nmol 30 nmol
Shipped within 5-10 working days.

TCF12 siRNA
20-abx936326	Abbexa	EUR 661.2 EUR 878.4	15 nmol 30 nmol
Shipped within 5-10 working days.

TCF12 Antibody
5999-002mg	ProSci	0.02 mg	EUR 206.18
Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: TCF12 Antibody: TCF12, also known as HTF4, is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. TCF12 is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. TCF12, in combination with E2A, is required to block thymocyte proliferation prior to pre-TCR expression and is critical for proper T cell differentiation. Recent reports have shown that TCF12 is also a critical factor required for the development of invariant natural killer T cells.

TCF12 Antibody
5999-01mg	ProSci	0.1 mg	EUR 523.7
Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: TCF12 Antibody: TCF12, also known as HTF4, is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. TCF12 is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. TCF12, in combination with E2A, is required to block thymocyte proliferation prior to pre-TCR expression and is critical for proper T cell differentiation. Recent reports have shown that TCF12 is also a critical factor required for the development of invariant natural killer T cells.

TCF12 antibody
70R-20737	Fitzgerald	50 ul	EUR 522
Description: Rabbit polyclonal TCF12 antibody

TCF12 Antibody
25198-100ul	SAB	100ul	EUR 468

TCF12 Antibody
1-CSB-PA023293ESR1HU	Cusabio	EUR 266.4 EUR 402	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TCF12. Recognizes TCF12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

TCF12 Antibody
1-CSB-PA023293GA01HU	Cusabio	EUR 716.4 EUR 399.6	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TCF12. Recognizes TCF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TCFAP2C Blocking Peptide
33R-8315	Fitzgerald	100 ug	EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TCFAP2C antibody, catalog no. 20R-1252

TCF4 / TCF12 Antibody
20-abx328599	Abbexa	EUR 376.8 EUR 292.8	100 ug 50 ug
Shipped within 5-10 working days.

TCF4 / TCF12 Antibody
abx332742-100ul	Abbexa	100 ul	EUR 510
Shipped within 5-10 working days.

TCF4/TCF12 Antibody
CSB-PA090601-	Cusabio	each	EUR 402
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TCF4/TCF12. Recognizes TCF4/TCF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TCF4/TCF12 Antibody
CSB-PA090601-100ul	Cusabio	100ul	EUR 379.2
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TCF4/TCF12. Recognizes TCF4/TCF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TCF4/TCF12 Antibody
1-CSB-PA004249	Cusabio	EUR 266.4 EUR 234	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TCF4/TCF12. Recognizes TCF4/TCF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

TCF12 Rabbit pAb
A4146-100ul	Abclonal	100 ul	EUR 369.6

TCF12 Rabbit pAb
A4146-200ul	Abclonal	200 ul	EUR 550.8

TCF12 Rabbit pAb
A4146-20ul	Abclonal	20 ul	EUR 219.6

TCF12 Rabbit pAb
A4146-50ul	Abclonal	50 ul	EUR 267.6

TCF12 cloning plasmid
CSB-CL023293HU-10ug	Cusabio	10ug	EUR 568.8
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2121 Sequence: atgaatccccagcaacaacgcatggccgctatagggaccgacaaggagctgagcgacctactggacttcagtgcgatgttttccccacctgttaatagtgggaaaactagaccaactacactgggaagcagtcagttcagtggatcaggtattgatgaaagaggaggtacaacat Show more
Description: A cloning plasmid for the TCF12 gene.

TCF12 Polyclonal Antibody
30526-100ul	SAB	100ul	EUR 302.4

TCF12 Polyclonal Antibody
30526-50ul	SAB	50ul	EUR 224.4

Rat TCF12 shRNA Plasmid
20-abx985250	Abbexa	EUR 961.2 EUR 1345.2	150 µg 300 µg
Shipped within 15-20 working days.

anti- TCF12/HEB antibody
FNab08552	FN Test	100µg	EUR 658.5
Immunogen: transcription factor 12 Uniprot ID: Q99081 Research Area: Epigenetics, Metabolism, Developmental biology
Description: Antibody raised against TCF12/HEB

Mouse TCF12 shRNA Plasmid
20-abx973019	Abbexa	EUR 961.2 EUR 1345.2	150 µg 300 µg
Shipped within 15-20 working days.

Human TCF12 shRNA Plasmid
20-abx954756	Abbexa	EUR 961.2 EUR 1345.2	150 µg 300 µg
Shipped within 15-20 working days.

TCF12 Recombinant Protein (Rat)
RP232592	ABM	100 ug	Ask for price

TCF12 Recombinant Protein (Mouse)
RP177770	ABM	100 ug	Ask for price

TCF12 Recombinant Protein (Mouse)
RP177773	ABM	100 ug	Ask for price

TCF12 Recombinant Protein (Mouse)
RP177776	ABM	100 ug	Ask for price

TCF12 Recombinant Protein (Mouse)
RP177779	ABM	100 ug	Ask for price

TCF12 Recombinant Protein (Mouse)
RP177782	ABM	100 ug	Ask for price

TCF12 Recombinant Protein (Human)
RP031147	ABM	100 ug	Ask for price

TCF12 Polyclonal Conjugated Antibody
C30526	SAB	100ul	EUR 476.4

TCF12/HEB ELISA KIT|Human
EF003496	Lifescience Market	96 Tests	EUR 826.8

Tcf12 ORF Vector (Rat) (pORF)
ORF077532	ABM	1.0 ug DNA	EUR 607.2

TCF12 ORF Vector (Human) (pORF)
ORF010383	ABM	1.0 ug DNA	EUR 114

Tcf12 ORF Vector (Mouse) (pORF)
ORF059258	ABM	1.0 ug DNA	EUR 1886.4

Tcf12 ORF Vector (Mouse) (pORF)
ORF059259	ABM	1.0 ug DNA	EUR 1886.4

Tcf12 ORF Vector (Mouse) (pORF)
ORF059260	ABM	1.0 ug DNA	EUR 607.2

Tcf12 ORF Vector (Mouse) (pORF)
ORF059261	ABM	1.0 ug DNA	EUR 1886.4

Tcf12 ORF Vector (Mouse) (pORF)
ORF059262	ABM	1.0 ug DNA	EUR 607.2

[One Step] TCF12 Antibody Kit
RK05714	Abclonal	50 ul	EUR 288

Transcription Factor 12 (TCF12) Antibody
20-abx321364	Abbexa	EUR 360 EUR 292.8	100 ul 50 ul
Shipped within 5-10 working days.

Transcription Factor 12 (TCF12) Antibody
20-abx003060	Abbexa	EUR 493.2 EUR 710.4 EUR 218.4 EUR 376.8	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Transcription Factor 12 (TCF12) Antibody
abx028344-400ul	Abbexa	400 ul	EUR 627.6
Shipped within 5-10 working days.

Transcription Factor 12 (TCF12) Antibody
abx028344-80l	Abbexa	80 µl	EUR 343.2
Shipped within 5-10 working days.

Tcf12 sgRNA CRISPR Lentivector set (Rat)
K6796101	ABM	3 x 1.0 ug	EUR 406.8

Tcf12 sgRNA CRISPR Lentivector set (Mouse)
K4450901	ABM	3 x 1.0 ug	EUR 406.8

TCF12 sgRNA CRISPR Lentivector set (Human)
K2349301	ABM	3 x 1.0 ug	EUR 406.8

TCF12 3'UTR GFP Stable Cell Line
TU075322	ABM	1.0 ml	EUR 2799.6

Tcf12 3'UTR GFP Stable Cell Line
TU271694	ABM	1.0 ml	Ask for price

Tcf12 3'UTR GFP Stable Cell Line
TU170268	ABM	1.0 ml	Ask for price

TCF12 Protein Vector (Rat) (pPM-C-HA)
PV310128	ABM	500 ng	EUR 1399.2

TCF12 Protein Vector (Rat) (pPB-C-His)
PV310126	ABM	500 ng	EUR 1399.2

TCF12 Protein Vector (Rat) (pPB-N-His)
PV310127	ABM	500 ng	EUR 1399.2

TCF12 Protein Vector (Rat) (pPM-C-His)
PV310129	ABM	500 ng	EUR 1399.2

TCF12 Protein Vector (Human) (pPM-C-HA)
PV041531	ABM	500 ng	EUR 394.8

TCF12 Protein Vector (Mouse) (pPM-C-HA)
PV237032	ABM	500 ng	EUR 2756.4

TCF12 Protein Vector (Mouse) (pPM-C-HA)
PV237036	ABM	500 ng	EUR 2863.2

When the outcomes have been adjusted for the efficiency of the earlier inspection, for each proportion enhance in on-line class involvement within the examination SNQ solely elevated by 0.05% (95% CI: 0.02 to 0.08) on common.