Student perceptions of online and in-person microbiology laboratory experiences in undergraduate medical education.

Student perceptions of online and in-person microbiology laboratory experiences in undergraduate medical education.

Background: Universities face rising budgetary constraints, usually leading to fewer funds to help microbiology laboratory. On-line actions mock labs usually instituted as an economical various to conventional moist labs for medical college students.Goal: The intention of this examine is to check the scholars’ perceptions of on-line and in-person studying experiences.Design microbiology lab: We examine the notion of undergraduate medical college students from in-person and on-line microbiology laboratory expertise; 164 first yr medical college students participated in a web-based lab newly designed, whereas 83 second-year medical college students proceed to make use of within the laboratory. A web-based survey is given what college students collect from expertise.

Sheep Amyloid Beta Peptide 1-42 (Ab1-42) ELISA Kit

abx364753-96tests 96 tests
EUR 1111.2
  • Shipped within 5-12 working days.

IA-1 Peptide

5415P 0.05 mg
EUR 197.7
Description: (NT) IA-1 peptide

IA-6 Peptide

5417P 0.05 mg
EUR 197.7
Description: (CT) IA-6 peptide

RXR beta Peptide

45-140P 0.1 mg
EUR 405.6
Description: (IN) RXR beta Peptide

B56 beta Peptide

45-312P 0.1 mg
EUR 405.6
Description: B56 beta Peptide

Il12 beta Peptide

45-766P 0.1 mg
EUR 405.6
Description: Il12b / Il12p40 Peptide

Beta-actin Peptide

3777P 0.05 mg
EUR 197.7
Description: (CT) Beta-actin peptide

Beta-actin Peptide

3779P 0.05 mg
EUR 197.7
Description: (NT) Beta-actin peptide

beta Casomorphin Peptide

20-abx265093
  • EUR 427.2
  • EUR 644.4
  • EUR 343.2
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Casomorphin Peptide

20-abx265429
  • EUR 427.2
  • EUR 644.4
  • EUR 343.2
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

IL-1 beta Peptide

43-610P 0.1 mg
EUR 405.6

IKK beta (C3) Peptide

2121P 0.05 mg
EUR 197.7
Description: (CT3) IKK beta (C3) peptide

beta Bag Cell Peptide

20-abx265792
  • EUR 393.6
  • EUR 594
  • EUR 326.4
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta I probe Peptide

20-abx266491
  • EUR 693.6
  • EUR 1195.2
  • EUR 493.2
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Neuroprotectin Peptide

20-abx266216
  • EUR 560.4
  • EUR 910.8
  • EUR 410.4
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta-Galactosidase Peptide

5155P 0.05 mg
EUR 197.7
Description: (NT) beta-Galactosidase peptide

beta-Bag Cell Peptide

5-00467 4 x 5mg Ask for price

Stick sheet

2312212 4unit
EUR 295.2
Description: 2pcs

Integrin beta 5 Peptide

45-777P 0.1 mg
EUR 405.6
Description: Integrin beta 5 Peptide

CG beta Blocking Peptide

20-abx062414
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

LT beta Blocking Peptide

20-abx162554
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Salusin beta Peptide (OVA)

20-abx165597
  • EUR 693.6
  • EUR 309.6
  • EUR 2064
  • EUR 828
  • EUR 510
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TCR beta Blocking Peptide

5651BP-50 each
EUR 183.6

hCG beta Blocking Peptide

AF0177-BP 1mg
EUR 234

RAR beta Blocking Peptide

20-abx063184
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

TCR beta Blocking Peptide

33R-10581 50 ug
EUR 418.8
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TCR beta antibody, catalog no. 20R-1838

TGF beta Blocking Peptide

33R-11047 50 ug
EUR 229.2
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TGF beta antibody, catalog no. 70R-12368

TCR beta Blocking Peptide

33R-11054 50 ug
EUR 229.2
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TCR beta antibody, catalog no. 70R-12401

IL1 beta Blocking Peptide

33R-2037 100 ug
EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IL1B antibody, catalog no. 70R-5695

IL1 beta Blocking Peptide

33R-5648 100 ug
EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IL1B antibody, catalog no. 70R-5694

NGF beta Blocking Peptide

20-abx061125
  • EUR 343.2
  • EUR 510
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CK2 beta Blocking Peptide

20-abx062480
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

DGK beta Blocking Peptide

20-abx062525
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

IFN beta Blocking Peptide

20-abx062768
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

TNF beta Blocking Peptide

20-abx062891
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

IKK beta Blocking Peptide

20-abx063002
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

NGF beta Blocking Peptide

AF5172-BP 1mg
EUR 234

PKC beta Blocking Peptide

20-abx161381
  • EUR 727.2
  • EUR 1713.6
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

IKK beta Blocking Peptide

20-abx161893
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

IKK beta Blocking Peptide

20-abx161894
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

FSH beta Blocking Peptide

20-abx162438
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

TCR beta Blocking Peptide

DF8621-BP 1mg
EUR 234

CBF beta Blocking Peptide

DF3273-BP 1mg
EUR 234

SDF1 beta Blocking Peptide

33R-11044 50 ug
EUR 229.2
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDF1 beta antibody, catalog no. 70R-12340

HNF1 beta Blocking Peptide

20-abx061843
  • EUR 309.6
  • EUR 460.8
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

GSK3 beta Blocking Peptide

AF7814-BP 1mg
EUR 234

HNF1 beta Blocking Peptide

AF5394-BP 1mg
EUR 234

GSK3 beta Blocking Peptide

AF5016-BP 1mg
EUR 234

IDH3 beta Blocking Peptide

20-abx161135
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HIF1 beta Blocking Peptide

20-abx161546
  • EUR 727.2
  • EUR 1713.6
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

GSK3 beta Blocking Peptide

20-abx162471
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

TIF1 beta Blocking Peptide

DF7531-BP 1mg
EUR 234

Karyopherin beta 1 Peptide

45-791P 0.1 mg
EUR 405.6
Description: Karyopherin Peptide

beta Actin Blocking Peptide

33R-9203 100 ug
EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACTB antibody, catalog no. 70R-2519

beta Actin Blocking Peptide

33R-10536 50 ug
EUR 418.8
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of beta Actin antibody, catalog no. 20R-1696

beta Actin Blocking Peptide

33R-10559 50 ug
EUR 418.8
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of beta Actin antibody, catalog no. 20R-1744

beta Actin Blocking Peptide

33R-10860 50 ug
EUR 229.2
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of beta Actin antibody, catalog no. 70R-11980

beta Actin Blocking Peptide

33R-7326 100 ug
EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACTB antibody, catalog no. 70R-2908

CaMKK beta Blocking Peptide

20-abx061337
  • EUR 343.2
  • EUR 510
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CaMK2 beta Blocking Peptide

20-abx062321
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PDGFR beta Blocking Peptide

20-abx063061
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PDGFR beta Blocking Peptide

AF6132-BP 1mg
EUR 234

PDGFR beta Blocking Peptide

AF6133-BP 1mg
EUR 234

beta Actin Blocking Peptide

AF7018-BP 1mg
EUR 234

HSP90 beta Blocking Peptide

BF9107-BP 1mg
EUR 234

HSP90 beta Blocking Peptide

20-abx161643
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

MaxiK beta Blocking Peptide

DF8571-BP 1mg
EUR 234

beta Casein (90-96) Peptide

20-abx265830
  • EUR 427.2
  • EUR 644.4
  • EUR 343.2
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Human Amyloid Beta Peptide 1-40 (Ab1-40) Peptide

20-abx652283
  • EUR 376.8
  • EUR 243.6
  • EUR 927.6
  • EUR 410.4
  • EUR 309.6
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Amyloid Beta Peptide 1-40 (Ab1-40) Peptide

abx670346-1mg 1 mg
EUR 627.6
  • Shipped within 1 week.

Resistin-like beta Peptide

46-892P 0.1 mg
EUR 405.6
Description: RELMbeta Peptide

Klotho Beta Blocking Peptide

33R-1868 100 ug
EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KLB antibody, catalog no. 70R-7053

GADD45 beta Blocking Peptide

20-abx064181
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Neo-Endorphin Peptide

20-abx266131
  • EUR 493.2
  • EUR 794.4
  • EUR 376.8
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Amyloid (32-35) Peptide

20-abx265735
  • EUR 393.6
  • EUR 594
  • EUR 326.4
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Amyloid (31-35) Peptide

20-abx265759
  • EUR 393.6
  • EUR 594
  • EUR 326.4
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Amyloid (17-21) Peptide

20-abx265783
  • EUR 393.6
  • EUR 594
  • EUR 326.4
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Amyloid (16-20) Peptide

20-abx265795
  • EUR 393.6
  • EUR 594
  • EUR 326.4
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Amyloid (15-21) Peptide

20-abx265883
  • EUR 427.2
  • EUR 644.4
  • EUR 343.2
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Amyloid (16-23) Peptide

20-abx265994
  • EUR 460.8
  • EUR 710.4
  • EUR 360
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Amyloid (12-20) Peptide

20-abx266143
  • EUR 493.2
  • EUR 794.4
  • EUR 376.8
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Amyloid (25-35) Peptide

20-abx266223
  • EUR 560.4
  • EUR 910.8
  • EUR 410.4
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Amyloid (35-25) Peptide

20-abx266224
  • EUR 560.4
  • EUR 910.8
  • EUR 410.4
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Amyloid (18-28) Peptide

20-abx266239
  • EUR 560.4
  • EUR 910.8
  • EUR 410.4
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Amyloid (16-26) Peptide

20-abx266242
  • EUR 560.4
  • EUR 910.8
  • EUR 410.4
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Amyloid (10-20) Peptide

20-abx266263
  • EUR 560.4
  • EUR 910.8
  • EUR 410.4
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Amyloid (11-22) Peptide

20-abx266325
  • EUR 594
  • EUR 978
  • EUR 427.2
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Outcomes lab: When it comes to self-reported scholar’s studying type, college students who attend non-public labs have been extra prone to report a tactile studying type (33% vs 16%), whereas the scholars are studying the fabric on-line reporting preferences visible studying type (77% vs 61%; n = 264). College students really feel that the microbiology lab on-line is extra handy for his or her schedule when in comparison with in-person laboratory.

Most on-line college students (12%) felt that they meet the brand new materials on the finish of the quiz the scholars within the (1%; n = 245). Even so, 43% of scholars are educated on-line and 37% of the coed vote in an informed perceived lab expertise they’re assigned to be a design lab that’s optimum, and greater than 89% of each teams reported a need for no less than some in-person instruction within the setting.

wet-lab Conclusions: our findings recommend that, whereas the scholars are very supportive digital on-line lab actions, the vast majority of college students nonetheless reported a need for a mixture of on-line and in-person, hands-on lab actions.

These findings can be directed analysis college students’ perceptions of laboratory expertise and help in microbiology curriculum variations to accommodate each college students and the college wants.

 Student perceptions of online and in-person microbiology laboratory experiences in undergraduate medical education.
Scholar perceptions of on-line and in-person microbiology laboratory experiences in undergraduate medical schooling.

E-learning can enhance the efficiency of graduate medical college students in Medical Microbiology examination?

Medical Microbiology is a core topic within the medical undergraduate curriculum. Nevertheless, college students wrestle to cowl the contents and scientific microbiology fundamental contextualization. Our goal is to judge the coed’s involvement with the brand new e-learning supplies and to research the influence on efficiency audit in Medical Microbiology module.

 

A web-based useful resource designed to help the didactic educating Fundamentals of Medical Microbiology module.

One group of scholars have entry to on-line materials (2017/2018 class) and others not (2016/2017 class). Every group sat collectively a number of selection query (MCQ) and a brief question-notes (SNQ) examination paper and the influence of engagement with the assets and efficiency checks on-line is identical group analysed.

Each tutorial requirements earlier than beginning the module. Within the 2017/2018 cohort, 227/309 (73.5%) college students had ≥80% engagement with the content material.

College students are concerned principally with indices of pathogens and pathogen centered scientific case associated to a spread of genera and households are clinically essential microorganisms. Increased statistical distinction within the common proportion of fine grade in MCQ and SNQ examination seems for 2017/2018 in contrast with 2016/2017 cohort. For the MCQ examination, the 2017/2018 cohort was on common 5:57% (95% confidence interval (CI): 3.92 to 7.24%; P <0.001) larger, and for the examination of the 2017/2018 SNQ cohort common of two.08% (95% CI: 0.74 to three.41%; P = 0.02) larger.

TCF25 Blocking Peptide
33R-3842 100 ug
EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TCF25 antibody, catalog no. 70R-8726
TCF25 Blocking Peptide
33R-8470 100 ug
EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TCF25 antibody, catalog no. 20R-1266
TCF23 Blocking Peptide
33R-7226 100 ug
EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TCF23 antibody, catalog no. 20R-1160
TCF19 Blocking Peptide
DF9971-BP 1mg
EUR 234
TCF3 Blocking Peptide
20-abx063331
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
TCF7 Blocking Peptide
20-abx063332
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
TCF3 Blocking Peptide
33R-10627 50 ug
EUR 229.2
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TCF3 antibody, catalog no. 70R-11605
TCF3 Blocking Peptide
BF0632-BP 1mg
EUR 234
TCF6 Blocking Peptide
20-abx162059
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
TCF7 Blocking Peptide
DF7179-BP 1mg
EUR 234
TCF4 Blocking Peptide
DF6275-BP 1mg
EUR 234
TCF2 Blocking Peptide
DF10056-BP 1mg
EUR 234
TCF3 Blocking Peptide
DF3097-BP 1mg
EUR 234
TCF7 Blocking Peptide
DF3168-BP 1mg
EUR 234
Tcf7l2 Blocking Peptide
33R-10305 100 ug
EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Tcf7l2 antibody, catalog no. 70R-8381
TCF7L2 Blocking Peptide
DF7622-BP 1mg
EUR 234
TCF7L1 Blocking Peptide
DF4573-BP 1mg
EUR 234
TCF4 / 12 Blocking Peptide
20-abx161486
  • EUR 727.2
  • EUR 1713.6
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
TCF4/12 Blocking Peptide
DF4572-BP 1mg
EUR 234
TCF3/E2A Blocking Peptide
3090BP-50 each
EUR 183.6
TCF12/HEB (TCF12) Antibody
abx238552-100ug 100 ug
EUR 610.8
  • Shipped within 5-12 working days.
Tcfec Peptide
46-474P 0.1 mg
EUR 405.6
Description: Tcfec Peptide
TCFL5 Peptide
46-475P 0.1 mg
EUR 405.6
Description: CHA / TCFL5 Peptide
Tcf12/ Rat Tcf12 ELISA Kit
ELI-48272r 96 Tests
EUR 1063.2
Human TCF12/HEB (TCF12) ELISA Kit
abx259881-96tests 96 tests
EUR 1093.2
  • Shipped within 5-12 working days.
TCFL4 Blocking Peptide
20-abx063335
  • EUR 326.4
  • EUR 493.2
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
TCFL5 Blocking Peptide
20-abx061246
  • EUR 343.2
  • EUR 510
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
TCFL5 Blocking Peptide
AF9211-BP 1mg
EUR 234
TCF12 siRNA
20-abx905499
  • EUR 661.2
  • EUR 878.4
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TCF12 siRNA
20-abx936325
  • EUR 661.2
  • EUR 878.4
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TCF12 siRNA
20-abx936326
  • EUR 661.2
  • EUR 878.4
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TCF12 Antibody
5999-002mg 0.02 mg
EUR 206.18
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: TCF12 Antibody: TCF12, also known as HTF4, is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. TCF12 is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. TCF12, in combination with E2A, is required to block thymocyte proliferation prior to pre-TCR expression and is critical for proper T cell differentiation. Recent reports have shown that TCF12 is also a critical factor required for the development of invariant natural killer T cells.
TCF12 Antibody
5999-01mg 0.1 mg
EUR 523.7
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: TCF12 Antibody: TCF12, also known as HTF4, is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. TCF12 is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. TCF12, in combination with E2A, is required to block thymocyte proliferation prior to pre-TCR expression and is critical for proper T cell differentiation. Recent reports have shown that TCF12 is also a critical factor required for the development of invariant natural killer T cells.
TCF12 antibody
70R-20737 50 ul
EUR 522
Description: Rabbit polyclonal TCF12 antibody
TCF12 Antibody
25198-100ul 100ul
EUR 468
TCF12 Antibody
1-CSB-PA023293ESR1HU
  • EUR 266.4
  • EUR 402
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TCF12. Recognizes TCF12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000
TCF12 Antibody
1-CSB-PA023293GA01HU
  • EUR 716.4
  • EUR 399.6
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TCF12. Recognizes TCF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
TCFAP2C Blocking Peptide
33R-8315 100 ug
EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TCFAP2C antibody, catalog no. 20R-1252
TCF4 / TCF12 Antibody
20-abx328599
  • EUR 376.8
  • EUR 292.8
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
TCF4 / TCF12 Antibody
abx332742-100ul 100 ul
EUR 510
  • Shipped within 5-10 working days.
TCF4/TCF12 Antibody
CSB-PA090601- each
EUR 402
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TCF4/TCF12. Recognizes TCF4/TCF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TCF4/TCF12 Antibody
CSB-PA090601-100ul 100ul
EUR 379.2
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TCF4/TCF12. Recognizes TCF4/TCF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TCF4/TCF12 Antibody
1-CSB-PA004249
  • EUR 266.4
  • EUR 234
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TCF4/TCF12. Recognizes TCF4/TCF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
TCF12 Rabbit pAb
A4146-100ul 100 ul
EUR 369.6
TCF12 Rabbit pAb
A4146-200ul 200 ul
EUR 550.8
TCF12 Rabbit pAb
A4146-20ul 20 ul
EUR 219.6
TCF12 Rabbit pAb
A4146-50ul 50 ul
EUR 267.6
TCF12 cloning plasmid
CSB-CL023293HU-10ug 10ug
EUR 568.8
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2121
  • Sequence: atgaatccccagcaacaacgcatggccgctatagggaccgacaaggagctgagcgacctactggacttcagtgcgatgttttccccacctgttaatagtgggaaaactagaccaactacactgggaagcagtcagttcagtggatcaggtattgatgaaagaggaggtacaacat
  • Show more
Description: A cloning plasmid for the TCF12 gene.
TCF12 Polyclonal Antibody
30526-100ul 100ul
EUR 302.4
TCF12 Polyclonal Antibody
30526-50ul 50ul
EUR 224.4
Rat TCF12 shRNA Plasmid
20-abx985250
  • EUR 961.2
  • EUR 1345.2
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
anti- TCF12/HEB antibody
FNab08552 100µg
EUR 658.5
  • Immunogen: transcription factor 12
  • Uniprot ID: Q99081
  • Research Area: Epigenetics, Metabolism, Developmental biology
Description: Antibody raised against TCF12/HEB
Mouse TCF12 shRNA Plasmid
20-abx973019
  • EUR 961.2
  • EUR 1345.2
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TCF12 shRNA Plasmid
20-abx954756
  • EUR 961.2
  • EUR 1345.2
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TCF12 Recombinant Protein (Rat)
RP232592 100 ug Ask for price
TCF12 Recombinant Protein (Mouse)
RP177770 100 ug Ask for price
TCF12 Recombinant Protein (Mouse)
RP177773 100 ug Ask for price
TCF12 Recombinant Protein (Mouse)
RP177776 100 ug Ask for price
TCF12 Recombinant Protein (Mouse)
RP177779 100 ug Ask for price
TCF12 Recombinant Protein (Mouse)
RP177782 100 ug Ask for price
TCF12 Recombinant Protein (Human)
RP031147 100 ug Ask for price
TCF12 Polyclonal Conjugated Antibody
C30526 100ul
EUR 476.4
TCF12/HEB ELISA KIT|Human
EF003496 96 Tests
EUR 826.8
Tcf12 ORF Vector (Rat) (pORF)
ORF077532 1.0 ug DNA
EUR 607.2
TCF12 ORF Vector (Human) (pORF)
ORF010383 1.0 ug DNA
EUR 114
Tcf12 ORF Vector (Mouse) (pORF)
ORF059258 1.0 ug DNA
EUR 1886.4
Tcf12 ORF Vector (Mouse) (pORF)
ORF059259 1.0 ug DNA
EUR 1886.4
Tcf12 ORF Vector (Mouse) (pORF)
ORF059260 1.0 ug DNA
EUR 607.2
Tcf12 ORF Vector (Mouse) (pORF)
ORF059261 1.0 ug DNA
EUR 1886.4
Tcf12 ORF Vector (Mouse) (pORF)
ORF059262 1.0 ug DNA
EUR 607.2
[One Step] TCF12 Antibody Kit
RK05714 50 ul
EUR 288
Transcription Factor 12 (TCF12) Antibody
20-abx321364
  • EUR 360
  • EUR 292.8
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Transcription Factor 12 (TCF12) Antibody
20-abx003060
  • EUR 493.2
  • EUR 710.4
  • EUR 218.4
  • EUR 376.8
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Transcription Factor 12 (TCF12) Antibody
abx028344-400ul 400 ul
EUR 627.6
  • Shipped within 5-10 working days.
Transcription Factor 12 (TCF12) Antibody
abx028344-80l 80 µl
EUR 343.2
  • Shipped within 5-10 working days.
Tcf12 sgRNA CRISPR Lentivector set (Rat)
K6796101 3 x 1.0 ug
EUR 406.8
Tcf12 sgRNA CRISPR Lentivector set (Mouse)
K4450901 3 x 1.0 ug
EUR 406.8
TCF12 sgRNA CRISPR Lentivector set (Human)
K2349301 3 x 1.0 ug
EUR 406.8
TCF12 3'UTR GFP Stable Cell Line
TU075322 1.0 ml
EUR 2799.6
Tcf12 3'UTR GFP Stable Cell Line
TU271694 1.0 ml Ask for price
Tcf12 3'UTR GFP Stable Cell Line
TU170268 1.0 ml Ask for price
TCF12 Protein Vector (Rat) (pPM-C-HA)
PV310128 500 ng
EUR 1399.2
TCF12 Protein Vector (Rat) (pPB-C-His)
PV310126 500 ng
EUR 1399.2
TCF12 Protein Vector (Rat) (pPB-N-His)
PV310127 500 ng
EUR 1399.2
TCF12 Protein Vector (Rat) (pPM-C-His)
PV310129 500 ng
EUR 1399.2
TCF12 Protein Vector (Human) (pPM-C-HA)
PV041531 500 ng
EUR 394.8
TCF12 Protein Vector (Mouse) (pPM-C-HA)
PV237032 500 ng
EUR 2756.4
TCF12 Protein Vector (Mouse) (pPM-C-HA)
PV237036 500 ng
EUR 2863.2

When the outcomes have been adjusted for the efficiency of the earlier inspection, for each proportion enhance in on-line class involvement within the examination SNQ solely elevated by 0.05% (95% CI: 0.02 to 0.08) on common.

Leave A Comment