Student perceptions of online and in-person microbiology laboratory experiences in undergraduate medical education.

Student perceptions of online and in-person microbiology laboratory experiences in undergraduate medical education.

Background: Universities face rising budgetary constraints, usually leading to fewer funds to help microbiology laboratory. On-line actions mock labs usually instituted as an economical various to conventional moist labs for medical college students.Goal: The intention of this examine is to check the scholars’ perceptions of on-line and in-person studying experiences.Design microbiology lab: We examine the notion of undergraduate medical college students from in-person and on-line microbiology laboratory expertise; 164 first yr medical college students participated in a web-based lab newly designed, whereas 83 second-year medical college students proceed to make use of within the laboratory. A web-based survey is given what college students collect from expertise.

Gel Breaker Tubes

KS071012-12 12
EUR 89
Description: Premade ready to use kits will always come in handy. Get your experiment done right form the first try by using a validated kit with perfectly balanced reagents proportions and compatibility and by following a clear protocol.

Recombinant Human GHRH Protein, Untagged, E.coli-5mg

QP10643-5mg 5mg
EUR 463

Recombinant Yeast IDH1 Protein, Untagged, Yeast-5mg

QP10670-5mg 5mg
EUR 201

Recombinant Mouse Leptin Protein, Untagged, E.coli-5mg

QP10756-5mg 5mg
EUR 517

Recombinant other Lysostaphin Protein, Untagged, E.coli-5mg

QP10778-5mg 5mg
EUR 264

Recombinant other Urease Protein, Untagged, E.coli-5mg

QP10907-5mg 5mg
EUR 201

Recombinant other Antide Protein, Untagged, E.coli-5mg

QP11028-5mg 5mg
EUR 201

Recombinant other Bivalirudin Protein, Untagged, E.coli-5mg

QP11165-5mg 5mg
EUR 201

Recombinant Multi Species Buserelin Protein, Untagged, -5mg

QP11214-5mg 5mg
EUR 327

Recombinant Salmon Calcitonin Protein, Untagged, E.coli-5mg

QP11261-5mg 5mg
EUR 391

Recombinant Human CRP Protein, Untagged, E.coli-5mg

QP11513-5mg 5mg
EUR 1415

Recombinant other DDAVP Protein, Untagged, E.coli-5mg

QP11607-5mg 5mg
EUR 201

Recombinant other Deslorelin Protein, Untagged, E.coli-5mg

QP11661-5mg 5mg
EUR 155

Recombinant Human EDN3 Protein, Untagged, E.coli-5mg

QP11747-5mg 5mg
EUR 1388

Recombinant other Eledoisin Protein, Untagged, E.coli-5mg

QP11778-5mg 5mg
EUR 155

Recombinant Human Eptifibatide Protein, Untagged, E.coli-5mg

QP11802-5mg 5mg
EUR 155

Recombinant other Goserelin Protein, Untagged, E.coli-5mg

QP12027-5mg 5mg
EUR 146

Recombinant other Pramlintide Protein, Untagged, E.coli-5mg

QP13132-5mg 5mg
EUR 201

Recombinant Human Secretin Protein, Untagged, E.coli-5mg

QP13449-5mg 5mg
EUR 201

Recombinant Human SERPINA1 Protein, Untagged, E.coli-5mg

QP13455-5mg 5mg
EUR 762

Recombinant other Sincalide Protein, Untagged, E.coli-5mg

QP13506-5mg 5mg
EUR 201

Recombinant Rabbit TNC Protein, Untagged, Rabbit-5mg

QP13765-5mg 5mg
EUR 617

Recombinant Human Leptin Protein, Untagged, E.coli-5mg

QP5350-5mg 5mg
EUR 318

Recombinant Mouse Leptin Protein, Untagged, E.coli-5mg

QP5429-5mg 5mg
EUR 563

Recombinant Rat Leptin Protein, Untagged, E.coli-5mg

QP5507-5mg 5mg
EUR 536

Recombinant other Histrelin Protein, Untagged, E.coli-5mg

QP12236-5mg 5mg
EUR 201

Recombinant Human Leuprorelin Protein, Untagged, E.coli-5mg

QP12555-5mg 5mg
EUR 155

Recombinant other Lypressin Protein, Untagged, E.coli-5mg

QP12608-5mg 5mg
EUR 155

Recombinant other MOG Protein, Untagged, E.coli-5mg

QP12717-5mg 5mg
EUR 201

Recombinant Human OCT Protein, Untagged, E.coli-5mg

QP12920-5mg 5mg
EUR 281

Recombinant Human OT Protein, Untagged, E.coli-5mg

QP12937-5mg 5mg
EUR 155

Stick sheet

2312212 4unit
EUR 246
Description: 2pcs

Foam Sheet

BV1010-00 1 PC
EUR 94.58
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Recombinant other Avidin Protein, Untagged, Native Protein-5mg

QP10525-5mg 5mg
EUR 155

Recombinant Rat Carboxypeptidase B Protein, Untagged, E.coli-5mg

QP10544-5mg 5mg
EUR 155

Recombinant other hCG Protein, Untagged, Native Protein-5mg

QP10664-5mg 5mg
EUR 182

Recombinant Human MG Protein, Untagged, Native Protein-5mg

QP10785-5mg 5mg
EUR 327

Recombinant Human Thrombin Protein, Untagged, Native Protein-5mg

QP10880-5mg 5mg
EUR 3356

Recombinant Human Trypsin-2 Protein, Untagged, E.coli-5mg

QP10899-5mg 5mg
EUR 201

Recombinant Human UTI Protein, Untagged, Native Protein-5mg

QP10909-5mg 5mg
EUR 155

Recombinant Human APOH Protein, Untagged, Native Protein-5mg

QP11054-5mg 5mg
EUR 3356

Recombinant Bovine ECGS Protein, Untagged, Native Protein-5mg

QP11736-5mg 5mg
EUR 155

Recombinant Human EDN2 Protein, Untagged, Native Protein-5mg

QP11746-5mg 5mg
EUR 590

Recombinant Human GHRP 2 Protein, Untagged, E.coli-5mg

QP11968-5mg 5mg
EUR 155

Recombinant other GHRP 6 Protein, Untagged, E.coli-5mg

QP11969-5mg 5mg
EUR 155

Recombinant other Streptavidin Protein, Untagged, Native Protein-5mg

QP13625-5mg 5mg
EUR 155

Recombinant other Thymosin ?1 Protein, Untagged, E.coli-5mg

QP13745-5mg 5mg
EUR 608

Recombinant Multi Species Trp Protein, Untagged, E.coli-5mg

QP13821-5mg 5mg
EUR 163

Recombinant Human Urokinase Protein, Untagged, Native Protein-5mg

QP13908-5mg 5mg
EUR 563

Recombinant Multi Species Vasopressin Protein, Untagged, E.coli-5mg

QP13923-5mg 5mg
EUR 155

Recombinant Bovine Alkaline Phosphatase Protein, Untagged, Native Protein-5mg

QP10518-5mg 5mg
EUR 264

Recombinant Human IGF1 Isoform 2 Protein, Untagged, E.coli-5mg

QP5005-5mg 5mg
EUR 1289

Recombinant Mouse EGF/ Epidermal Growth Factor Protein, Untagged, E.coli-5mg

QP4008-5mg 5mg
EUR 1161

Recombinant Human EGF/ Epidermal Growth Factor Protein, Untagged, E.coli-5mg

QP5334-5mg 5mg
EUR 1161

Recombinant Human GH1/ Growth hormone 1 Protein, Untagged, E.coli-5mg

QP5354-5mg 5mg
EUR 726

Recombinant S. aureus E. coli ssPA/ Stringent starvation Protein, Untagged, E.coli-5mg

QP5524-5mg 5mg
EUR 2503

SingleStep Poly-HRP Anti-Mouse IgG (H+L) Secondary Antibody, HRP-5mg

Q2AB1-5mg 5mg
EUR 623

SingleStep Poly-HRP Anti-Rabbit IgG (H+L) Secondary Antibody, HRP-5mg

Q2AB2-5mg 5mg
EUR 623

Recombinant Human IGF1 Isoform 2 Protein, Untagged, E.coli-5mg

QP10392-ec-5mg 5mg
EUR 318

L-NIL: (5mg)

00242 5MG
EUR 172
Description: Minimum order quantity: 1 unit of 5MG

L-NIO: (5mg)

00243 5MG
EUR 172
Description: Minimum order quantity: 1 unit of 5MG

Fluorescein-DHPE: (5mg)

60024 5MG
EUR 226
Description: Minimum order quantity: 1 unit of 5MG

Rhodamine-DHPE: (5mg)

60026 5MG
EUR 226
Description: Minimum order quantity: 1 unit of 5MG

SynaptoRed C1: (5mg)

70040 5MG
EUR 278
Description: Minimum order quantity: 1 unit of 5MG

SynaptoGreenTM C1: (5mg)

70042 5MG
EUR 278
Description: Minimum order quantity: 1 unit of 5MG

SynaptoGreen C5: (5mg)

70046 5MG
EUR 278
Description: Minimum order quantity: 1 unit of 5MG

RuBP-4S: (5mg)

80025 5MG
EUR 239
Description: Minimum order quantity: 1 unit of 5MG


GA9971-5MG 5 mg
EUR 390


Z008-5MG 5 mg
EUR 446


Z011-5MG 5 mg
EUR 492

beta-Sitosterol, 97%

GP9580-5MG 5 mg
EUR 102

Oxytocin Peptide Protein

abx169025-5mg 5 mg
EUR 384
  • Shipped within 5-10 working days.

TSH beta Antibody (HRP)

abx022899-5mg 5 mg
EUR 3878
  • Shipped within 5-10 working days.

Linear Polyacrylamide (5mg/ml)

S143 1 ml
EUR 40

Biotin-X-DHPE: (5mg)

60023 5MG
EUR 237
Description: Minimum order quantity: 1 unit of 5MG

Arachidonic Acid 5mg/ml

ABP-ARA-1 3 x 0,5ml vials
EUR 57

Bacteria beta Galactosidase (GLB1) Protein

abx670038-5mg 5 mg
EUR 439
  • Shipped within 1 week.

Human Insulin B Peptide

abx670051-5mg 5 mg
EUR 356
  • Shipped within 1 week.


356008 1/pk
EUR 447
Description: Advanced Cells - DL; ECM - DL

DMNPE-Caged D-Luciferin: (5mg)

10103 5MG
EUR 148
Description: Minimum order quantity: 1 unit of 5MG

Biotin-X-C5-maleimide: (5mg)

90058 5MG
EUR 188
Description: Minimum order quantity: 1 unit of 5MG

Aminooxy-5(6)-ROX: (5mg)

90104 5MG
EUR 242
Description: Minimum order quantity: 1 unit of 5MG

5-TAMRA-PEO3-amine: (5mg)

90107 5MG
EUR 372
Description: Minimum order quantity: 1 unit of 5MG

PNPP sodium salt, 5mg tablets

GX3711-100EA 100 EA
EUR 252

beta Casomorphin Peptide

  • EUR 356.00
  • EUR 537.00
  • EUR 286.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Casomorphin Peptide

  • EUR 356.00
  • EUR 537.00
  • EUR 286.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Neuroprotectin Peptide

  • EUR 467.00
  • EUR 759.00
  • EUR 342.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Outcomes lab: When it comes to self-reported scholar’s studying type, college students who attend non-public labs have been extra prone to report a tactile studying type (33% vs 16%), whereas the scholars are studying the fabric on-line reporting preferences visible studying type (77% vs 61%; n = 264). College students really feel that the microbiology lab on-line is extra handy for his or her schedule when in comparison with in-person laboratory.

Most on-line college students (12%) felt that they meet the brand new materials on the finish of the quiz the scholars within the (1%; n = 245). Even so, 43% of scholars are educated on-line and 37% of the coed vote in an informed perceived lab expertise they’re assigned to be a design lab that’s optimum, and greater than 89% of each teams reported a need for no less than some in-person instruction within the setting.

wet-lab Conclusions: our findings recommend that, whereas the scholars are very supportive digital on-line lab actions, the vast majority of college students nonetheless reported a need for a mixture of on-line and in-person, hands-on lab actions.

These findings can be directed analysis college students’ perceptions of laboratory expertise and help in microbiology curriculum variations to accommodate each college students and the college wants.

 Student perceptions of online and in-person microbiology laboratory experiences in undergraduate medical education.
Scholar perceptions of on-line and in-person microbiology laboratory experiences in undergraduate medical schooling.

E-learning can enhance the efficiency of graduate medical college students in Medical Microbiology examination?

Medical Microbiology is a core topic within the medical undergraduate curriculum. Nevertheless, college students wrestle to cowl the contents and scientific microbiology fundamental contextualization. Our goal is to judge the coed’s involvement with the brand new e-learning supplies and to research the influence on efficiency audit in Medical Microbiology module.


A web-based useful resource designed to help the didactic educating Fundamentals of Medical Microbiology module.

One group of scholars have entry to on-line materials (2017/2018 class) and others not (2016/2017 class). Every group sat collectively a number of selection query (MCQ) and a brief question-notes (SNQ) examination paper and the influence of engagement with the assets and efficiency checks on-line is identical group analysed.

Each tutorial requirements earlier than beginning the module. Within the 2017/2018 cohort, 227/309 (73.5%) college students had ≥80% engagement with the content material.

College students are concerned principally with indices of pathogens and pathogen centered scientific case associated to a spread of genera and households are clinically essential microorganisms. Increased statistical distinction within the common proportion of fine grade in MCQ and SNQ examination seems for 2017/2018 in contrast with 2016/2017 cohort. For the MCQ examination, the 2017/2018 cohort was on common 5:57% (95% confidence interval (CI): 3.92 to 7.24%; P <0.001) larger, and for the examination of the 2017/2018 SNQ cohort common of two.08% (95% CI: 0.74 to three.41%; P = 0.02) larger.

TCF12 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TCF12. Recognizes TCF12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000
TCF12 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TCF12. Recognizes TCF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
TCF12 Antibody
25198-100ul 100ul
EUR 390
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA24817 50 ul
EUR 334
Description: Mouse polyclonal to TCF12
TCF12 antibody
70R-20737 50 ul
EUR 435
Description: Rabbit polyclonal TCF12 antibody
TCF12 Antibody
5999-002mg 0.02 mg
EUR 171.82
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: TCF12 Antibody: TCF12, also known as HTF4, is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. TCF12 is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. TCF12, in combination with E2A, is required to block thymocyte proliferation prior to pre-TCR expression and is critical for proper T cell differentiation. Recent reports have shown that TCF12 is also a critical factor required for the development of invariant natural killer T cells.
TCF12 Antibody
5999-01mg 0.1 mg
EUR 436.42
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: TCF12 Antibody: TCF12, also known as HTF4, is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. TCF12 is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. TCF12, in combination with E2A, is required to block thymocyte proliferation prior to pre-TCR expression and is critical for proper T cell differentiation. Recent reports have shown that TCF12 is also a critical factor required for the development of invariant natural killer T cells.
TCF12 cloning plasmid
CSB-CL023293HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2121
  • Sequence: atgaatccccagcaacaacgcatggccgctatagggaccgacaaggagctgagcgacctactggacttcagtgcgatgttttccccacctgttaatagtgggaaaactagaccaactacactgggaagcagtcagttcagtggatcaggtattgatgaaagaggaggtacaacat
  • Show more
Description: A cloning plasmid for the TCF12 gene.
TCF4/TCF12 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TCF4/TCF12. Recognizes TCF4/TCF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
TCF4/TCF12 Antibody
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TCF4/TCF12. Recognizes TCF4/TCF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TCF4/TCF12 Antibody
CSB-PA090601-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TCF4/TCF12. Recognizes TCF4/TCF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
Anti-TCF12 antibody
STJ25790 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. This encoded protein is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined.
TCF12 Polyclonal Antibody
30526-100ul 100ul
EUR 252
TCF12 Polyclonal Antibody
30526-50ul 50ul
EUR 187
TCF12 Rabbit pAb
A4146-100ul 100 ul
EUR 308
TCF12 Rabbit pAb
A4146-200ul 200 ul
EUR 459
TCF12 Rabbit pAb
A4146-20ul 20 ul
EUR 183
TCF12 Rabbit pAb
A4146-50ul 50 ul
EUR 223
TCF4 / TCF12 Antibody
abx332742-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
TCF4 / TCF12 Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-TCF12 (2E9)
YF-MA10923 100 ug
EUR 363
Description: Mouse monoclonal to TCF12
Rat TCF12 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TCF12 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TCF12 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TCF12 Polyclonal Conjugated Antibody
C30526 100ul
EUR 397
anti- TCF12/HEB antibody
FNab08552 100µg
EUR 548.75
  • Immunogen: transcription factor 12
  • Uniprot ID: Q99081
  • Research Area: Epigenetics, Metabolism, Developmental biology
Description: Antibody raised against TCF12/HEB
Anti-TCF12/HEB antibody
PAab08552 100 ug
EUR 386
TCF12 Recombinant Protein (Human)
RP031147 100 ug Ask for price
TCF12 Recombinant Protein (Mouse)
RP177770 100 ug Ask for price
TCF12 Recombinant Protein (Mouse)
RP177773 100 ug Ask for price
TCF12 Recombinant Protein (Mouse)
RP177776 100 ug Ask for price
TCF12 Recombinant Protein (Mouse)
RP177779 100 ug Ask for price
TCF12 Recombinant Protein (Mouse)
RP177782 100 ug Ask for price
TCF12 Recombinant Protein (Rat)
RP232592 100 ug Ask for price
[One Step] TCF12 Antibody Kit
RK05714 50 ul
EUR 240
Transcription Factor 12 (TCF12) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Transcription Factor 12 (TCF12) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Transcription Factor 12 (TCF12) Antibody
abx028344-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Transcription Factor 12 (TCF12) Antibody
abx028344-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
EF003496 96 Tests
EUR 689
TCF12 ORF Vector (Human) (pORF)
ORF010383 1.0 ug DNA
EUR 95
Tcf12 ORF Vector (Mouse) (pORF)
ORF059258 1.0 ug DNA
EUR 1572
Tcf12 ORF Vector (Mouse) (pORF)
ORF059259 1.0 ug DNA
EUR 1572
Tcf12 ORF Vector (Mouse) (pORF)
ORF059260 1.0 ug DNA
EUR 506
Tcf12 ORF Vector (Mouse) (pORF)
ORF059261 1.0 ug DNA
EUR 1572
Tcf12 ORF Vector (Mouse) (pORF)
ORF059262 1.0 ug DNA
EUR 506
Tcf12 ORF Vector (Rat) (pORF)
ORF077532 1.0 ug DNA
EUR 506
Canine C-Peptide ELISA Kit
RD-C-Peptide-c-48Tests 48 Tests
EUR 533
Canine C-Peptide ELISA Kit
RD-C-Peptide-c-96Tests 96 Tests
EUR 740
Human C-Peptide ELISA Kit
RD-C-Peptide-Hu-48Tests 48 Tests
EUR 387
Human C-Peptide ELISA Kit
RD-C-Peptide-Hu-96Tests 96 Tests
EUR 532
Mouse C-Peptide ELISA Kit
RD-C-Peptide-Mu-48Tests 48 Tests
EUR 446
Mouse C-Peptide ELISA Kit
RD-C-Peptide-Mu-96Tests 96 Tests
EUR 615
Rat C-Peptide ELISA Kit
RD-C-Peptide-Ra-48Tests 48 Tests
EUR 465
Rat C-Peptide ELISA Kit
RD-C-Peptide-Ra-96Tests 96 Tests
EUR 643
Canine C-Peptide ELISA Kit
DLR-C-Peptide-c-48T 48T
EUR 527
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Canine C-Peptide ELISA Kit
DLR-C-Peptide-c-96T 96T
EUR 688
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human C-Peptide ELISA Kit
DLR-C-Peptide-Hu-48T 48T
EUR 398
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human C-Peptide ELISA Kit
DLR-C-Peptide-Hu-96T 96T
EUR 511
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse C-Peptide ELISA Kit
DLR-C-Peptide-Mu-48T 48T
EUR 450
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse C-Peptide ELISA Kit
DLR-C-Peptide-Mu-96T 96T
EUR 582
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat C-Peptide ELISA Kit
DLR-C-Peptide-Ra-48T 48T
EUR 467
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat C-Peptide ELISA Kit
DLR-C-Peptide-Ra-96T 96T
EUR 605
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Canine C-Peptide ELISA Kit
RDR-C-Peptide-c-48Tests 48 Tests
EUR 557
Canine C-Peptide ELISA Kit
RDR-C-Peptide-c-96Tests 96 Tests
EUR 774
Human C-Peptide ELISA Kit
RDR-C-Peptide-Hu-48Tests 48 Tests
EUR 404
Human C-Peptide ELISA Kit
RDR-C-Peptide-Hu-96Tests 96 Tests
EUR 556
Mouse C-Peptide ELISA Kit
RDR-C-Peptide-Mu-48Tests 48 Tests
EUR 465
Mouse C-Peptide ELISA Kit
RDR-C-Peptide-Mu-96Tests 96 Tests
EUR 643
Rat C-Peptide ELISA Kit
RDR-C-Peptide-Ra-48Tests 48 Tests
EUR 486
Rat C-Peptide ELISA Kit
RDR-C-Peptide-Ra-96Tests 96 Tests
EUR 672
TCF12 sgRNA CRISPR Lentivector set (Human)
K2349301 3 x 1.0 ug
EUR 339
Tcf12 sgRNA CRISPR Lentivector set (Mouse)
K4450901 3 x 1.0 ug
EUR 339
Tcf12 sgRNA CRISPR Lentivector set (Rat)
K6796101 3 x 1.0 ug
EUR 339
Human Transcription factor 12, TCF12 ELISA KIT
ELI-20838h 96 Tests
EUR 824
Chicken Transcription factor 12, TCF12 ELISA KIT
ELI-13223c 96 Tests
EUR 928
Mouse Transcription factor 12, Tcf12 ELISA KIT
ELI-13224m 96 Tests
EUR 865
TCF12 sgRNA CRISPR Lentivector (Human) (Target 1)
K2349302 1.0 ug DNA
EUR 154
TCF12 sgRNA CRISPR Lentivector (Human) (Target 2)
K2349303 1.0 ug DNA
EUR 154
TCF12 sgRNA CRISPR Lentivector (Human) (Target 3)
K2349304 1.0 ug DNA
EUR 154
Tcf12 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4450902 1.0 ug DNA
EUR 154
Tcf12 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4450903 1.0 ug DNA
EUR 154
Tcf12 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4450904 1.0 ug DNA
EUR 154
Tcf12 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6796102 1.0 ug DNA
EUR 154
Tcf12 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6796103 1.0 ug DNA
EUR 154

When the outcomes have been adjusted for the efficiency of the earlier inspection, for each proportion enhance in on-line class involvement within the examination SNQ solely elevated by 0.05% (95% CI: 0.02 to 0.08) on common.

Leave A Comment