Student perceptions of online and in-person microbiology laboratory experiences in undergraduate medical education.

Student perceptions of online and in-person microbiology laboratory experiences in undergraduate medical education.

Background: Universities face rising budgetary constraints, usually leading to fewer funds to help microbiology laboratory. On-line actions mock labs usually instituted as an economical various to conventional moist labs for medical college students.Goal: The intention of this examine is to check the scholars’ perceptions of on-line and in-person studying experiences.Design microbiology lab: We examine the notion of undergraduate medical college students from in-person and on-line microbiology laboratory expertise; 164 first yr medical college students participated in a web-based lab newly designed, whereas 83 second-year medical college students proceed to make use of within the laboratory. A web-based survey is given what college students collect from expertise.

Gel Breaker Tubes

KS071012-12 12
EUR 106.8
Description: Premade ready to use kits will always come in handy. Get your experiment done right form the first try by using a validated kit with perfectly balanced reagents proportions and compatibility and by following a clear protocol.

Recombinant Human Leuprorelin Protein, Untagged, E.coli-5mg

QP12555-5mg 5mg
EUR 186

Recombinant other Lypressin Protein, Untagged, E.coli-5mg

QP12608-5mg 5mg
EUR 186

Recombinant other MOG Protein, Untagged, E.coli-5mg

QP12717-5mg 5mg
EUR 241.2

Recombinant Human OCT Protein, Untagged, E.coli-5mg

QP12920-5mg 5mg
EUR 337.2

Recombinant Human OT Protein, Untagged, E.coli-5mg

QP12937-5mg 5mg
EUR 186

Recombinant other Pramlintide Protein, Untagged, E.coli-5mg

QP13132-5mg 5mg
EUR 241.2

Recombinant Human Secretin Protein, Untagged, E.coli-5mg

QP13449-5mg 5mg
EUR 241.2

Recombinant Human SERPINA1 Protein, Untagged, E.coli-5mg

QP13455-5mg 5mg
EUR 914.4

Recombinant other Sincalide Protein, Untagged, E.coli-5mg

QP13506-5mg 5mg
EUR 241.2

Recombinant Rabbit TNC Protein, Untagged, Rabbit-5mg

QP13765-5mg 5mg
EUR 740.4

Recombinant Human GHRH Protein, Untagged, E.coli-5mg

QP10643-5mg 5mg
EUR 555.6

Recombinant Yeast IDH1 Protein, Untagged, Yeast-5mg

QP10670-5mg 5mg
EUR 241.2

Recombinant Mouse Leptin Protein, Untagged, E.coli-5mg

QP10756-5mg 5mg
EUR 620.4

Recombinant other Lysostaphin Protein, Untagged, E.coli-5mg

QP10778-5mg 5mg
EUR 316.8

Recombinant other Urease Protein, Untagged, E.coli-5mg

QP10907-5mg 5mg
EUR 241.2

Recombinant other Antide Protein, Untagged, E.coli-5mg

QP11028-5mg 5mg
EUR 241.2

Recombinant other Bivalirudin Protein, Untagged, E.coli-5mg

QP11165-5mg 5mg
EUR 241.2

Recombinant Multi Species Buserelin Protein, Untagged, -5mg

QP11214-5mg 5mg
EUR 392.4

Recombinant Human Leptin Protein, Untagged, E.coli-5mg

QP5350-5mg 5mg
EUR 381.6

Recombinant Mouse Leptin Protein, Untagged, E.coli-5mg

QP5429-5mg 5mg
EUR 675.6

Recombinant Rat Leptin Protein, Untagged, E.coli-5mg

QP5507-5mg 5mg
EUR 643.2

Recombinant Salmon Calcitonin Protein, Untagged, E.coli-5mg

QP11261-5mg 5mg
EUR 469.2

Recombinant Human CRP Protein, Untagged, E.coli-5mg

QP11513-5mg 5mg
EUR 1698

Recombinant other DDAVP Protein, Untagged, E.coli-5mg

QP11607-5mg 5mg
EUR 241.2

Recombinant other Deslorelin Protein, Untagged, E.coli-5mg

QP11661-5mg 5mg
EUR 186

Recombinant Human EDN3 Protein, Untagged, E.coli-5mg

QP11747-5mg 5mg
EUR 1665.6

Recombinant other Eledoisin Protein, Untagged, E.coli-5mg

QP11778-5mg 5mg
EUR 186

Recombinant Human Eptifibatide Protein, Untagged, E.coli-5mg

QP11802-5mg 5mg
EUR 186

Recombinant other Goserelin Protein, Untagged, E.coli-5mg

QP12027-5mg 5mg
EUR 175.2

Recombinant other Histrelin Protein, Untagged, E.coli-5mg

QP12236-5mg 5mg
EUR 241.2

Recombinant other Avidin Protein, Untagged, Native Protein-5mg

QP10525-5mg 5mg
EUR 186

Recombinant Rat Carboxypeptidase B Protein, Untagged, E.coli-5mg

QP10544-5mg 5mg
EUR 186

Recombinant other Streptavidin Protein, Untagged, Native Protein-5mg

QP13625-5mg 5mg
EUR 186

Recombinant other Thymosin ?1 Protein, Untagged, E.coli-5mg

QP13745-5mg 5mg
EUR 729.6

Recombinant Multi Species Trp Protein, Untagged, E.coli-5mg

QP13821-5mg 5mg
EUR 195.6

Recombinant Human Urokinase Protein, Untagged, Native Protein-5mg

QP13908-5mg 5mg
EUR 675.6

Recombinant Multi Species Vasopressin Protein, Untagged, E.coli-5mg

QP13923-5mg 5mg
EUR 186

Recombinant other hCG Protein, Untagged, Native Protein-5mg

QP10664-5mg 5mg
EUR 218.4

Recombinant Human MG Protein, Untagged, Native Protein-5mg

QP10785-5mg 5mg
EUR 392.4

Recombinant Human Thrombin Protein, Untagged, Native Protein-5mg

QP10880-5mg 5mg
EUR 4027.2

Recombinant Human Trypsin-2 Protein, Untagged, E.coli-5mg

QP10899-5mg 5mg
EUR 241.2

Recombinant Human UTI Protein, Untagged, Native Protein-5mg

QP10909-5mg 5mg
EUR 186

Recombinant Human APOH Protein, Untagged, Native Protein-5mg

QP11054-5mg 5mg
EUR 4027.2

Recombinant Bovine ECGS Protein, Untagged, Native Protein-5mg

QP11736-5mg 5mg
EUR 186

Recombinant Human EDN2 Protein, Untagged, Native Protein-5mg

QP11746-5mg 5mg
EUR 708

Recombinant Human GHRP 2 Protein, Untagged, E.coli-5mg

QP11968-5mg 5mg
EUR 186

Recombinant other GHRP 6 Protein, Untagged, E.coli-5mg

QP11969-5mg 5mg
EUR 186

Stick sheet

2312212 4unit
EUR 295.2
Description: 2pcs

Foam Sheet

BV1010-00 1 PC
EUR 113.5
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Recombinant Bovine Alkaline Phosphatase Protein, Untagged, Native Protein-5mg

QP10518-5mg 5mg
EUR 316.8

Recombinant Human IGF1 Isoform 2 Protein, Untagged, E.coli-5mg

QP5005-5mg 5mg
EUR 1546.8

Recombinant Mouse EGF/ Epidermal Growth Factor Protein, Untagged, E.coli-5mg

QP4008-5mg 5mg
EUR 1393.2

Recombinant Human EGF/ Epidermal Growth Factor Protein, Untagged, E.coli-5mg

QP5334-5mg 5mg
EUR 1393.2

Recombinant Human GH1/ Growth hormone 1 Protein, Untagged, E.coli-5mg

QP5354-5mg 5mg
EUR 871.2

beta Casomorphin Peptide

20-abx265093
  • EUR 427.20
  • EUR 644.40
  • EUR 343.20
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Casomorphin Peptide

20-abx265429
  • EUR 427.20
  • EUR 644.40
  • EUR 343.20
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Neuroprotectin Peptide

20-abx266216
  • EUR 560.40
  • EUR 910.80
  • EUR 410.40
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

SingleStep Poly-HRP Anti-Mouse IgG (H+L) Secondary Antibody, HRP-5mg

Q2AB1-5mg 5mg
EUR 747.6

SingleStep Poly-HRP Anti-Rabbit IgG (H+L) Secondary Antibody, HRP-5mg

Q2AB2-5mg 5mg
EUR 747.6

Recombinant S. aureus E. coli ssPA/ Stringent starvation Protein, Untagged, E.coli-5mg

QP5524-5mg 5mg
EUR 3003.6

Recombinant Human IGF1 Isoform 2 Protein, Untagged, E.coli-5mg

QP10392-ec-5mg 5mg
EUR 381.6

FSH beta Blocking Peptide

20-abx162438
  • EUR 326.40
  • EUR 493.20
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

GSK3 beta Blocking Peptide

20-abx162471
  • EUR 326.40
  • EUR 493.20
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta glucuronidase Blocking Peptide

20-abx162473
  • EUR 326.40
  • EUR 493.20
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

LT beta Blocking Peptide

20-abx162554
  • EUR 326.40
  • EUR 493.20
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

IDH3 beta Blocking Peptide

20-abx161135
  • EUR 326.40
  • EUR 493.20
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PKC beta Blocking Peptide

20-abx161381
  • EUR 727.20
  • EUR 1713.60
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HIF1 beta Blocking Peptide

20-abx161546
  • EUR 727.20
  • EUR 1713.60
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HSP90 beta Blocking Peptide

20-abx161643
  • EUR 326.40
  • EUR 493.20
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

IKK beta Blocking Peptide

20-abx161893
  • EUR 326.40
  • EUR 493.20
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

IKK beta Blocking Peptide

20-abx161894
  • EUR 326.40
  • EUR 493.20
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

NGF beta Blocking Peptide

20-abx061125
  • EUR 343.20
  • EUR 510.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CaMKK beta Blocking Peptide

20-abx061337
  • EUR 343.20
  • EUR 510.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Beta-adducin Blocking Peptide

20-abx061729
  • EUR 309.60
  • EUR 460.80
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Beta-catenin Blocking Peptide

20-abx061785
  • EUR 309.60
  • EUR 460.80
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta Galactosidase Blocking Peptide

20-abx061819
  • EUR 309.60
  • EUR 460.80
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HNF1 beta Blocking Peptide

20-abx061843
  • EUR 309.60
  • EUR 460.80
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta catenin Blocking Peptide

20-abx062087
  • EUR 326.40
  • EUR 493.20
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CaMK2 beta Blocking Peptide

20-abx062321
  • EUR 326.40
  • EUR 493.20
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CG beta Blocking Peptide

20-abx062414
  • EUR 326.40
  • EUR 493.20
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CK2 beta Blocking Peptide

20-abx062480
  • EUR 326.40
  • EUR 493.20
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta catenin Blocking Peptide

20-abx062487
  • EUR 326.40
  • EUR 493.20
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta catenin Blocking Peptide

20-abx062488
  • EUR 326.40
  • EUR 493.20
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

DGK beta Blocking Peptide

20-abx062525
  • EUR 326.40
  • EUR 493.20
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

IFN beta Blocking Peptide

20-abx062768
  • EUR 326.40
  • EUR 493.20
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Lutropin beta Blocking Peptide

20-abx062875
  • EUR 326.40
  • EUR 493.20
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Outcomes lab: When it comes to self-reported scholar’s studying type, college students who attend non-public labs have been extra prone to report a tactile studying type (33% vs 16%), whereas the scholars are studying the fabric on-line reporting preferences visible studying type (77% vs 61%; n = 264). College students really feel that the microbiology lab on-line is extra handy for his or her schedule when in comparison with in-person laboratory.

Most on-line college students (12%) felt that they meet the brand new materials on the finish of the quiz the scholars within the (1%; n = 245). Even so, 43% of scholars are educated on-line and 37% of the coed vote in an informed perceived lab expertise they’re assigned to be a design lab that’s optimum, and greater than 89% of each teams reported a need for no less than some in-person instruction within the setting.

wet-lab Conclusions: our findings recommend that, whereas the scholars are very supportive digital on-line lab actions, the vast majority of college students nonetheless reported a need for a mixture of on-line and in-person, hands-on lab actions.

These findings can be directed analysis college students’ perceptions of laboratory expertise and help in microbiology curriculum variations to accommodate each college students and the college wants.

 Student perceptions of online and in-person microbiology laboratory experiences in undergraduate medical education.
Scholar perceptions of on-line and in-person microbiology laboratory experiences in undergraduate medical schooling.

E-learning can enhance the efficiency of graduate medical college students in Medical Microbiology examination?

Medical Microbiology is a core topic within the medical undergraduate curriculum. Nevertheless, college students wrestle to cowl the contents and scientific microbiology fundamental contextualization. Our goal is to judge the coed’s involvement with the brand new e-learning supplies and to research the influence on efficiency audit in Medical Microbiology module.

 

A web-based useful resource designed to help the didactic educating Fundamentals of Medical Microbiology module.

One group of scholars have entry to on-line materials (2017/2018 class) and others not (2016/2017 class). Every group sat collectively a number of selection query (MCQ) and a brief question-notes (SNQ) examination paper and the influence of engagement with the assets and efficiency checks on-line is identical group analysed.

Each tutorial requirements earlier than beginning the module. Within the 2017/2018 cohort, 227/309 (73.5%) college students had ≥80% engagement with the content material.

College students are concerned principally with indices of pathogens and pathogen centered scientific case associated to a spread of genera and households are clinically essential microorganisms. Increased statistical distinction within the common proportion of fine grade in MCQ and SNQ examination seems for 2017/2018 in contrast with 2016/2017 cohort. For the MCQ examination, the 2017/2018 cohort was on common 5:57% (95% confidence interval (CI): 3.92 to 7.24%; P <0.001) larger, and for the examination of the 2017/2018 SNQ cohort common of two.08% (95% CI: 0.74 to three.41%; P = 0.02) larger.

TCF12 Antibody
5999-002mg 0.02 mg
EUR 206.18
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: TCF12 Antibody: TCF12, also known as HTF4, is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. TCF12 is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. TCF12, in combination with E2A, is required to block thymocyte proliferation prior to pre-TCR expression and is critical for proper T cell differentiation. Recent reports have shown that TCF12 is also a critical factor required for the development of invariant natural killer T cells.
TCF12 Antibody
5999-01mg 0.1 mg
EUR 523.7
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: TCF12 Antibody: TCF12, also known as HTF4, is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. TCF12 is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. TCF12, in combination with E2A, is required to block thymocyte proliferation prior to pre-TCR expression and is critical for proper T cell differentiation. Recent reports have shown that TCF12 is also a critical factor required for the development of invariant natural killer T cells.
TCF12 antibody
70R-20737 50 ul
EUR 522
Description: Rabbit polyclonal TCF12 antibody
TCF12 Antibody
25198-100ul 100ul
EUR 468
TCF12 siRNA
20-abx905499
  • EUR 661.20
  • EUR 878.40
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TCF12 siRNA
20-abx936325
  • EUR 661.20
  • EUR 878.40
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TCF12 siRNA
20-abx936326
  • EUR 661.20
  • EUR 878.40
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TCF12 Antibody
1-CSB-PA023293ESR1HU
  • EUR 266.40
  • EUR 402.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TCF12. Recognizes TCF12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000
TCF12 Antibody
1-CSB-PA023293GA01HU
  • EUR 716.40
  • EUR 399.60
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TCF12. Recognizes TCF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
anti-TCF12
YF-PA24817 50 ul
EUR 400.8
Description: Mouse polyclonal to TCF12
TCF12 Polyclonal Antibody
30526-100ul 100ul
EUR 302.4
TCF12 Polyclonal Antibody
30526-50ul 50ul
EUR 224.4
TCF12 Rabbit pAb
A4146-100ul 100 ul
EUR 369.6
TCF12 Rabbit pAb
A4146-200ul 200 ul
EUR 550.8
TCF12 Rabbit pAb
A4146-20ul 20 ul
EUR 219.6
TCF12 Rabbit pAb
A4146-50ul 50 ul
EUR 267.6
TCF4 / TCF12 Antibody
abx332742-100ul 100 ul
EUR 510
  • Shipped within 5-10 working days.
TCF4 / TCF12 Antibody
20-abx328599
  • EUR 376.80
  • EUR 292.80
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
TCF4/TCF12 Antibody
CSB-PA090601-
EUR 402
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TCF4/TCF12. Recognizes TCF4/TCF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TCF4/TCF12 Antibody
CSB-PA090601-100ul 100ul
EUR 379.2
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TCF4/TCF12. Recognizes TCF4/TCF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TCF12 cloning plasmid
CSB-CL023293HU-10ug 10ug
EUR 568.8
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2121
  • Sequence: atgaatccccagcaacaacgcatggccgctatagggaccgacaaggagctgagcgacctactggacttcagtgcgatgttttccccacctgttaatagtgggaaaactagaccaactacactgggaagcagtcagttcagtggatcaggtattgatgaaagaggaggtacaacat
  • Show more
Description: A cloning plasmid for the TCF12 gene.
TCF4/TCF12 Antibody
1-CSB-PA004249
  • EUR 266.40
  • EUR 234.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TCF4/TCF12. Recognizes TCF4/TCF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
Anti-TCF12 antibody
STJ25790 100 µl
EUR 332.4
Description: The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. This encoded protein is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined.
Anti-TCF12 (2E9)
YF-MA10923 100 ug
EUR 435.6
Description: Mouse monoclonal to TCF12
Human TCF12 shRNA Plasmid
20-abx954756
  • EUR 961.20
  • EUR 1345.20
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat TCF12 shRNA Plasmid
20-abx985250
  • EUR 961.20
  • EUR 1345.20
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TCF12 Polyclonal Conjugated Antibody
C30526 100ul
EUR 476.4
Mouse TCF12 shRNA Plasmid
20-abx973019
  • EUR 961.20
  • EUR 1345.20
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-TCF12/HEB antibody
PAab08552 100 ug
EUR 463.2
anti- TCF12/HEB antibody
FNab08552 100µg
EUR 658.5
  • Immunogen: transcription factor 12
  • Uniprot ID: Q99081
  • Research Area: Epigenetics, Metabolism, Developmental biology
Description: Antibody raised against TCF12/HEB
TCF12 Recombinant Protein (Human)
RP031147 100 ug Ask for price
TCF12 Recombinant Protein (Rat)
RP232592 100 ug Ask for price
TCF12 Recombinant Protein (Mouse)
RP177770 100 ug Ask for price
TCF12 Recombinant Protein (Mouse)
RP177773 100 ug Ask for price
TCF12 Recombinant Protein (Mouse)
RP177776 100 ug Ask for price
TCF12 Recombinant Protein (Mouse)
RP177779 100 ug Ask for price
TCF12 Recombinant Protein (Mouse)
RP177782 100 ug Ask for price
Transcription Factor 12 (TCF12) Antibody
20-abx003060
  • EUR 493.20
  • EUR 710.40
  • EUR 218.40
  • EUR 376.80
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Transcription Factor 12 (TCF12) Antibody
abx028344-400ul 400 ul
EUR 627.6
  • Shipped within 5-10 working days.
Transcription Factor 12 (TCF12) Antibody
abx028344-80l 80 µl
EUR 343.2
  • Shipped within 5-10 working days.
Transcription Factor 12 (TCF12) Antibody
20-abx321364
  • EUR 360.00
  • EUR 292.80
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tcf12 ORF Vector (Rat) (pORF)
ORF077532 1.0 ug DNA
EUR 607.2
Tcf12 ORF Vector (Mouse) (pORF)
ORF059258 1.0 ug DNA
EUR 1886.4
Tcf12 ORF Vector (Mouse) (pORF)
ORF059259 1.0 ug DNA
EUR 1886.4
Tcf12 ORF Vector (Mouse) (pORF)
ORF059260 1.0 ug DNA
EUR 607.2
Tcf12 ORF Vector (Mouse) (pORF)
ORF059261 1.0 ug DNA
EUR 1886.4
Tcf12 ORF Vector (Mouse) (pORF)
ORF059262 1.0 ug DNA
EUR 607.2
TCF12 ORF Vector (Human) (pORF)
ORF010383 1.0 ug DNA
EUR 114
TCF12/HEB ELISA KIT|Human
EF003496 96 Tests
EUR 826.8
[One Step] TCF12 Antibody Kit
RK05714 50 ul
EUR 288
Canine C-Peptide ELISA Kit
DLR-C-Peptide-c-48T 48T
EUR 632.4
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Canine C-Peptide ELISA Kit
DLR-C-Peptide-c-96T 96T
EUR 825.6
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human C-Peptide ELISA Kit
DLR-C-Peptide-Hu-48T 48T
EUR 477.6
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human C-Peptide ELISA Kit
DLR-C-Peptide-Hu-96T 96T
EUR 613.2
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse C-Peptide ELISA Kit
DLR-C-Peptide-Mu-48T 48T
EUR 540
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse C-Peptide ELISA Kit
DLR-C-Peptide-Mu-96T 96T
EUR 698.4
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat C-Peptide ELISA Kit
DLR-C-Peptide-Ra-48T 48T
EUR 560.4
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat C-Peptide ELISA Kit
DLR-C-Peptide-Ra-96T 96T
EUR 726
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Canine C-Peptide ELISA Kit
RD-C-Peptide-c-48Tests 48 Tests
EUR 639.6
Canine C-Peptide ELISA Kit
RD-C-Peptide-c-96Tests 96 Tests
EUR 888
Human C-Peptide ELISA Kit
RD-C-Peptide-Hu-48Tests 48 Tests
EUR 464.4
Human C-Peptide ELISA Kit
RD-C-Peptide-Hu-96Tests 96 Tests
EUR 638.4
Mouse C-Peptide ELISA Kit
RD-C-Peptide-Mu-48Tests 48 Tests
EUR 535.2
Mouse C-Peptide ELISA Kit
RD-C-Peptide-Mu-96Tests 96 Tests
EUR 738
Rat C-Peptide ELISA Kit
RD-C-Peptide-Ra-48Tests 48 Tests
EUR 558
Rat C-Peptide ELISA Kit
RD-C-Peptide-Ra-96Tests 96 Tests
EUR 771.6
Canine C-Peptide ELISA Kit
RDR-C-Peptide-c-48Tests 48 Tests
EUR 668.4
Canine C-Peptide ELISA Kit
RDR-C-Peptide-c-96Tests 96 Tests
EUR 928.8
Human C-Peptide ELISA Kit
RDR-C-Peptide-Hu-48Tests 48 Tests
EUR 484.8
Human C-Peptide ELISA Kit
RDR-C-Peptide-Hu-96Tests 96 Tests
EUR 667.2
Mouse C-Peptide ELISA Kit
RDR-C-Peptide-Mu-48Tests 48 Tests
EUR 558
Mouse C-Peptide ELISA Kit
RDR-C-Peptide-Mu-96Tests 96 Tests
EUR 771.6
Rat C-Peptide ELISA Kit
RDR-C-Peptide-Ra-48Tests 48 Tests
EUR 583.2
Rat C-Peptide ELISA Kit
RDR-C-Peptide-Ra-96Tests 96 Tests
EUR 806.4
Tcf12 sgRNA CRISPR Lentivector set (Rat)
K6796101 3 x 1.0 ug
EUR 406.8
Tcf12 sgRNA CRISPR Lentivector set (Mouse)
K4450901 3 x 1.0 ug
EUR 406.8
TCF12 sgRNA CRISPR Lentivector set (Human)
K2349301 3 x 1.0 ug
EUR 406.8
Goat Transcription factor 12(TCF12) ELISA kit
E06T0669-192T 192 tests
EUR 1524
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Transcription factor 12(TCF12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Transcription factor 12(TCF12) ELISA kit
E06T0669-48 1 plate of 48 wells
EUR 624
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Transcription factor 12(TCF12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Transcription factor 12(TCF12) ELISA kit
E06T0669-96 1 plate of 96 wells
EUR 822
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Transcription factor 12(TCF12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Transcription factor 12(TCF12) ELISA kit
E04T0669-192T 192 tests
EUR 1524
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transcription factor 12(TCF12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Transcription factor 12(TCF12) ELISA kit
E04T0669-48 1 plate of 48 wells
EUR 624
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transcription factor 12(TCF12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Transcription factor 12(TCF12) ELISA kit
E04T0669-96 1 plate of 96 wells
EUR 822
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transcription factor 12(TCF12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Transcription factor 12(TCF12) ELISA kit
E03T0669-192T 192 tests
EUR 1524
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transcription factor 12(TCF12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Transcription factor 12(TCF12) ELISA kit
E03T0669-48 1 plate of 48 wells
EUR 624
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transcription factor 12(TCF12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Transcription factor 12(TCF12) ELISA kit
E03T0669-96 1 plate of 96 wells
EUR 822
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transcription factor 12(TCF12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Transcription factor 12(TCF12) ELISA kit
E09T0669-192T 192 tests
EUR 1524
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transcription factor 12(TCF12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Transcription factor 12(TCF12) ELISA kit
E09T0669-48 1 plate of 48 wells
EUR 624
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transcription factor 12(TCF12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

When the outcomes have been adjusted for the efficiency of the earlier inspection, for each proportion enhance in on-line class involvement within the examination SNQ solely elevated by 0.05% (95% CI: 0.02 to 0.08) on common.

Leave A Comment