Analysis of student perceptions

Simply-In-Time Educating (JiTT) lively studying pedagogy utilized by numerous disciplines, however its worth in skilled pharmacy curriculum has not been confirmed.

The purpose of our analysis is to implement and consider this system JiTT (PharmD) Physician of Pharmacy. The impetus in implementing JiTT into PharmD curriculum is to offer college students with the alternative to be taught out-of-classroom to advertise knowledge-based expertise.

The present research summarizes the implementation JiTT in 4 totally different circumstances: two iterations of the required programs “Built-in Microbiology and Virology” (Fall 2016 and Fall 2017) and “Built-in Immunology” (winter 2016-2017 and winter 2017-2018). JiTT together with knowledge-based questions in a a number of alternative format, built-in case research, and the scholars reply earlier than the precise lecture. After the conclusion of every course, college students are requested to give suggestions on JiTT utilization by the use of nameless surveys.


After the Fall of 2016 iterations of Microbiology & Virology course, college students discover an built-in case research to be useful (imply = 3.27 from a most of 4, SD = 0.62), and their total assist JiTT excessive (imply = 3.61 exit 4, SD = 0.50).


MO15078 100 ug
EUR 383

HtrA2/Omi Antibody

48910-100ul 100ul
EUR 333

HtrA2/Omi Antibody

48910-50ul 50ul
EUR 239

HTRA2/Omi antibody

10R-1022 100 ul
EUR 316
Description: Mouse monoclonal HtrA2/Omi antibody

HtrA2/Omi Antibody

EUR 338

HtrA2/Omi Antibody

EUR 316

HtrA2/Omi Antibody

EUR 146

Polyclonal HtrA2/Omi Antibody

APR07891G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HtrA2/Omi . This antibody is tested and proven to work in the following applications:

Polyclonal HtrA2/Omi Antibody

APR07892G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HtrA2/Omi . This antibody is tested and proven to work in the following applications:

Anti-HtrA2/Omi Antibody

A01941-1 100ul
EUR 397
Description: Anti-HtrA2 Antibody

Anti-HtrA2/Omi antibody

STJ99318 200 µl
EUR 197
Description: Mouse monoclonal to HtrA2/Omi.

HtrA2/Omi Conjugated Antibody

C48910 100ul
EUR 397

Recombinant Human HTRA2/Omi Protein

RP00041 5 μg
EUR 136

HtrA2/Omi protein (His tag)

80R-1010 100 ug
EUR 224
Description: Purified recombinant Human HtrA2/Omi protein

Anti-HTRA2/Omi Rabbit Monoclonal Antibody

M01941 100ug/vial
EUR 397
Description: Rabbit Monoclonal HTRA2/Omi Antibody. Validated in IP, IHC, WB and tested in Human, Mouse, Rat.

Polyclonal HTRA2 / OMI Antibody (C-Terminus)

APR07884G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HTRA2 / OMI (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal HTRA2 / OMI Antibody (C-Terminus)

APR07885G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HTRA2 / OMI (C-Terminus). This antibody is tested and proven to work in the following applications:

OMI Peptide

3319P 0.05 mg
EUR 164.75
Description: (CT) OMI peptide

Anti-HtrA2/Omi (human) Monoclonal Antibody (196C429)

M01941-1 100ug
EUR 432
Description: Mouse Monoclonal HtrA2/Omi (human) Antibody (196C429). Validated in IHC, WB and tested in Human.

HTRA2 Blocking Peptide

DF7626-BP 1mg
EUR 195

HtrA2 Blocking Peptide

33R-10784 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HtrA2 antibody, catalog no. 70R-11873

Human High temperature requirement protein A 2(HtrA2/Omi)ELISA Kit

QY-E01443 96T
EUR 361

Omi Stress-Regulated Endoprotease (OMI) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

OMI Antibody

24178-100ul 100ul
EUR 390

OMI Antibody

24241-100ul 100ul
EUR 390

OMI Antibody

3051-002mg 0.02 mg
EUR 171.82
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: OMI Antibody: Inhibitor of apoptosis proteins (IAPs) were initially identified in baculoviruses as proteins that inhibit apoptosis of the host cells to allow time for viral replication. Cellular homologues containing at least one baculoviral IAP repeat (BIR) motif essential for their anti-apoptosis activity have been identified in yeasts and higher organisms and often act by binding and inhibiting processed caspases. The activity of these proteins can be modulated by the expression of proteins such as Smac/DIABLO and XAF-1 which displace or prevent the binding of caspases by IAPs. Recently, a mitochondrial serine protease termed Omi/HtrA2 has been found to bind IAPs. Similar to Smac, Omi possesses a conserved IAP-binding motif, but acts to cleave IAPs to irreversibly inactivate IAPs and promote apoptosis.

OMI Antibody

3051-01mg 0.1 mg
EUR 436.42
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: OMI Antibody: Inhibitor of apoptosis proteins (IAPs) were initially identified in baculoviruses as proteins that inhibit apoptosis of the host cells to allow time for viral replication. Cellular homologues containing at least one baculoviral IAP repeat (BIR) motif essential for their anti-apoptosis activity have been identified in yeasts and higher organisms and often act by binding and inhibiting processed caspases. The activity of these proteins can be modulated by the expression of proteins such as Smac/DIABLO and XAF-1 which displace or prevent the binding of caspases by IAPs. Recently, a mitochondrial serine protease termed Omi/HtrA2 has been found to bind IAPs. Similar to Smac, Omi possesses a conserved IAP-binding motif, but acts to cleave IAPs to irreversibly inactivate IAPs and promote apoptosis.

OMI Antibody

3319-002mg 0.02 mg
EUR 171.82
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: OMI Antibody: Inhibitor of apoptosis proteins (IAPs) were initially identified in baculoviruses as proteins that inhibit apoptosis of the host cells to allow time for viral replication. Cellular homologues containing at least one baculoviral IAP repeat (BIR) motif essential for their anti-apoptosis activity have been identified in yeasts and higher organisms and often act by binding and inhibiting processed caspases. The activity of these proteins can be modulated by the expression of proteins such as Smac/DIABLO and XAF-1 which displace or prevent the binding of caspases by IAPs. Recently, a mitochondrial serine protease termed Omi/HtrA2 has been found to bind IAPs. Similar to Smac, Omi possesses a conserved IAP-binding motif, but acts to cleave IAPs to irreversibly inactivate IAPs and promote apoptosis.

OMI Antibody

3319-01mg 0.1 mg
EUR 436.42
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: OMI Antibody: Inhibitor of apoptosis proteins (IAPs) were initially identified in baculoviruses as proteins that inhibit apoptosis of the host cells to allow time for viral replication. Cellular homologues containing at least one baculoviral IAP repeat (BIR) motif essential for their anti-apoptosis activity have been identified in yeasts and higher organisms and often act by binding and inhibiting processed caspases. The activity of these proteins can be modulated by the expression of proteins such as Smac/DIABLO and XAF-1 which displace or prevent the binding of caspases by IAPs. Recently, a mitochondrial serine protease termed Omi/HtrA2 has been found to bind IAPs. Similar to Smac, Omi possesses a conserved IAP-binding motif, but acts to cleave IAPs to irreversibly inactivate IAPs and promote apoptosis.

Phospho-HtrA2 (Ser212) Blocking Peptide

AF8275-BP 1mg
EUR 195

Phospho-HtrA2 (Ser142) Blocking Peptide

AF8381-BP 1mg
EUR 195

Polyclonal OMI Antibody

APR08860G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OMI . This antibody is tested and proven to work in the following applications:

Polyclonal OMI Antibody

APR08861G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OMI . This antibody is tested and proven to work in the following applications:

Serine Protease HTRA2, Mitochondrial (HTRA2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine Protease HTRA2, Mitochondrial (HTRA2) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine Protease HTRA2, Mitochondrial (HTRA2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine Protease HTRA2, Mitochondrial (HTRA2) Antibody

  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Serine Protease HTRA2, Mitochondrial (HTRA2) Antibody

abx234070-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Serine Protease HTRA2, Mitochondrial (HTRA2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine Protease HTRA2, Mitochondrial (HTRA2) Antibody

abx216095-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Serine protease HTRA2, mitochondrial (HTRA2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine protease HTRA2, mitochondrial (HTRA2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

HTRA2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HTRA2. Recognizes HTRA2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

HTRA2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HTRA2. Recognizes HTRA2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

HTRA2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HTRA2. Recognizes HTRA2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

HTRA2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against HTRA2. Recognizes HTRA2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

HTRA2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HTRA2. Recognizes HTRA2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HTRA2 Antibody

33024-100ul 100ul
EUR 252


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HTRA2 (Recombinant)

  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

HTRA2 Antibody

ABD7626 100 ug
EUR 438

HTRA2 Antibody

ABD7627 100 ug
EUR 438

HTRA2 Antibody

ABD7856 100 ug
EUR 438

HTRA2 Antibody

DF7626 200ul
EUR 304
Description: HTRA2 Antibody detects endogenous levels of total HTRA2.

HtrA2 antibody

10R-11428 100 ul
EUR 349
Description: Mouse Monoclonal HtrA2 antibody

HTRA2 antibody

70R-17856 50 ul
EUR 435
Description: Rabbit polyclonal HTRA2 antibody

HtrA2 antibody

70R-34522 100 ug
EUR 327
Description: Rabbit polyclonal HtrA2 antibody

HtrA2 antibody

70R-34644 100 ug
EUR 327
Description: Purified Rabbit polyclonal HtrA2 antibody

HTRA2 antibody

70R-11872 100 ug
EUR 447
Description: Rabbit polyclonal HTRA2 antibody

HTRA2 antibody

70R-11873 100 ug
EUR 403
Description: Rabbit polyclonal HTRA2 antibody


YF-PA26064 50 ul
EUR 334
Description: Mouse polyclonal to HTRA2

Serine Protease HTRA2, Mitochondrial (HTRA2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine Protease HTRA2, Mitochondrial (HTRA2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine Protease HTRA2, Mitochondrial (HTRA2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human HTRA2/ Serine protease HTRA2, mitochondrial ELISA Kit

E1191Hu 1 Kit
EUR 605

Human Serine protease HTRA2, mitochondrial (HTRA2) ELISA Kit

abx555557-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Serine protease HTRA2, mitochondrial (HTRA2) ELISA Kit

abx555624-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Cow Serine protease HTRA2, mitochondrial (HTRA2) ELISA Kit

abx555783-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Serine protease HTRA2, mitochondrial, Htra2 ELISA KIT

ELI-30990m 96 Tests
EUR 865

Bovine Serine protease HTRA2, mitochondrial, HTRA2 ELISA KIT

ELI-08586b 96 Tests
EUR 928

Human Serine protease HTRA2 mitochondrial, HTRA2 ELISA KIT

ELI-08587h 96 Tests
EUR 824

HTRA2 cloning plasmid

CSB-CL010902HU-10ug 10ug
EUR 495
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1377
  • Sequence: atggctgcgccgagggcggggcggggtgcaggctggagccttcgggcatggcgggctttggggggcattcgctgggggaggagaccccgtttgacccctgacctccgggccctgctgacgtcaggaacttctgacccccgggcccgagtgacttatgggacccccagtctctggg
  • Show more
Description: A cloning plasmid for the HTRA2 gene.

HtrA2 Polyclonal Antibody

ES5564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HtrA2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

HtrA2 Polyclonal Antibody

ES5564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HtrA2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

HtrA2 Polyclonal Antibody

ES5565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HtrA2 from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

HtrA2 Polyclonal Antibody

ES5565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HtrA2 from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

Anti-HTRA2 antibody

STJ28329 100 µl
EUR 277
Description: This gene encodes a serine protease. The protein has been localized in the endoplasmic reticulum and interacts with an alternatively spliced form of mitogen-activated protein kinase 14. The protein has also been localized to the mitochondria with release to the cytosol following apoptotic stimulus. The protein is thought to induce apoptosis by binding the apoptosis inhibitory protein baculoviral IAP repeat-containing 4. Nuclear localization of this protein has also been observed. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms.

Anti-HTRA2 antibody

STJ117077 100 µl
EUR 277
Description: This gene encodes a serine protease. The protein has been localized in the endoplasmic reticulum and interacts with an alternatively spliced form of mitogen-activated protein kinase 14. The protein has also been localized to the mitochondria with release to the cytosol following apoptotic stimulus. The protein is thought to induce apoptosis by binding the apoptosis inhibitory protein baculoviral IAP repeat-containing 4. Nuclear localization of this protein has also been observed. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms.

HtrA2 Polyclonal Antibody

ABP54565-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human HtrA2 around the non-phosphorylation site of S142
  • Applications tips:
Description: A polyclonal antibody for detection of HtrA2 from Human, Mouse, Rat. This HtrA2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HtrA2 around the non-phosphorylation site of S142

HtrA2 Polyclonal Antibody

ABP54565-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human HtrA2 around the non-phosphorylation site of S142
  • Applications tips:
Description: A polyclonal antibody for detection of HtrA2 from Human, Mouse, Rat. This HtrA2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HtrA2 around the non-phosphorylation site of S142

HtrA2 Polyclonal Antibody

ABP54565-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human HtrA2 around the non-phosphorylation site of S142
  • Applications tips:
Description: A polyclonal antibody for detection of HtrA2 from Human, Mouse, Rat. This HtrA2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HtrA2 around the non-phosphorylation site of S142

HtrA2 Polyclonal Antibody

ABP54566-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human HtrA2 around the non-phosphorylation site of S212
  • Applications tips:
Description: A polyclonal antibody for detection of HtrA2 from Human, Mouse, Rat. This HtrA2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HtrA2 around the non-phosphorylation site of S212

HtrA2 Polyclonal Antibody

ABP54566-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human HtrA2 around the non-phosphorylation site of S212
  • Applications tips:
Description: A polyclonal antibody for detection of HtrA2 from Human, Mouse, Rat. This HtrA2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HtrA2 around the non-phosphorylation site of S212

HtrA2 Polyclonal Antibody

ABP54566-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human HtrA2 around the non-phosphorylation site of S212
  • Applications tips:
Description: A polyclonal antibody for detection of HtrA2 from Human, Mouse, Rat. This HtrA2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HtrA2 around the non-phosphorylation site of S212

Recombinant Human HTRA2

7-02998 10µg Ask for price

Recombinant Human HTRA2

7-02999 50µg Ask for price

Recombinant Human HTRA2

7-03000 1mg Ask for price

HTRA2 Rabbit pAb

A5762-100ul 100 ul
EUR 308

HTRA2 Rabbit pAb

A5762-200ul 200 ul
EUR 459

HTRA2 Rabbit pAb

A5762-20ul 20 ul
EUR 183

HTRA2 Rabbit pAb

A5762-50ul 50 ul
EUR 223

HTRA2 Rabbit mAb

A3904-100ul 100 ul
EUR 410

HTRA2 Rabbit mAb

A3904-200ul 200 ul
EUR 571

HTRA2 Rabbit mAb

A3904-20ul 20 ul
EUR 221


For the three different packages which can be included on this research, the first dependent variable is the common worth of scholars from JiTT, rated on a five-point scale. Summing scores from the Fall 2017 iteration of the Built-in Microbiology & Virology course and the second instance of the Immunology course, college students are assessed JiTT very worthwhile (imply = 4.17 of a most of 5, SD = 0.77). scholar performances in JiTT primarily based packages in comparison with non-JiTT primarily based program.


Evaluation of evaluation knowledge on scholar efficiency on the knowledge-based questions present JiTT very useful for scholar studying and JiTT-based programs have a extra constant take a look at scores in comparison with non-JiTT primarily based program. The present outcomes are a promising first step in validating the usefulness JiTT in pharmaceutical packages and lay the groundwork for future research aiming for a direct comparability between the standard lecture model and JiTT pedagogy carried out into PharmD curriculum.

Analysis of Student Perceptions of Just-In-Time Teaching Pedagogy in PharmD Microbiology and Immunology Courses.
Evaluation of Pupil Perceptions of Simply-In-Time Educating Pedagogy in PharmD Microbiology and Immunology Programs.

Summative evaluation blueprint idea to undergraduate medical college students in microbiology

Background: Evaluation drives studying. written appraisal from many universities don’t have a uniform and validation. subjectivity appraisal affect. The blueprint has been used as a method of content material validity.

On this research, Maharashtra final 5-year College of Well being Sciences (MUHS) second 12 months MBBS papers in Microbiology evaluated for validity of its contents. Desired weightage to all of the subjects in microbiology given by the college’s Division of Microbiology. college papers are evaluated for degree of cognitive domains examined. Closed-ended suggestions from college taken and statistically evaluated.

Outcomes: The research revealed the overrepresentation and underrepresentation of many subjects in any respect the final 5 years the college paper with reference to microbiology. Cognitive dimensions examined in accordance query paper Bloom taxonomy revision was solely 8% of the Bloom degree 1, 20% of the extent 2, and eight% of the extent 3, whereas 64% of the questions had been ambiguous. College suggestions revealed a major impact (P <0.05) on blueprints in microbiology.

TSPAN9 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSPAN9. Recognizes TSPAN9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:500-1:1000, IF:1:200-1:500
TSPAN9 Antibody
25032-100ul 100ul
EUR 390
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TSPAN9 Antibody
5559-002mg 0.02 mg
EUR 171.82
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: TSPAN9 Antibody: The tetraspan family protein members are characterized by four predicted transmembrane domains and are thought to be involved in physiological processes such as tissue differentiation, immunological responses, and sperm-egg fusion. TSPAN9 has recently been identified as a platelet tetraspanin and a component of tetraspanin microdomains that include the collagen receptor GPVI (glycoprotein VI) and integrin alpha6beta1 but not the von Willebrand receptor GPIbalpha or the integrins alphaIIbbeta3 or alpha2beta1, suggesting that TSPAN9 may act to regulate platelet function in concert with other tetraspanins and their associated proteins.
TSPAN9 Antibody
5559-01mg 0.1 mg
EUR 436.42
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: TSPAN9 Antibody: The tetraspan family protein members are characterized by four predicted transmembrane domains and are thought to be involved in physiological processes such as tissue differentiation, immunological responses, and sperm-egg fusion. TSPAN9 has recently been identified as a platelet tetraspanin and a component of tetraspanin microdomains that include the collagen receptor GPVI (glycoprotein VI) and integrin alpha6beta1 but not the von Willebrand receptor GPIbalpha or the integrins alphaIIbbeta3 or alpha2beta1, suggesting that TSPAN9 may act to regulate platelet function in concert with other tetraspanins and their associated proteins.
Polyclonal TSPAN9 Antibody
AMM08357G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSPAN9 . This antibody is tested and proven to work in the following applications:
TSPAN9 Polyclonal Antibody
A68739 100 ?g
EUR 628.55
Description: fast delivery possible
TSPAN9 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSPAN9. Recognizes TSPAN9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TSPAN9 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSPAN9. Recognizes TSPAN9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TSPAN9 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSPAN9. Recognizes TSPAN9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Polyclonal TSPAN9 Antibody (Internal)
AMM08358G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSPAN9 (Internal). This antibody is tested and proven to work in the following applications:
Mouse TSPAN9 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TSPAN9 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Tetraspanin 9 (TSPAN9) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Tetraspanin 9 (TSPAN9) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tetraspanin 9 (TSPAN9) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
TSPAN9 Recombinant Protein (Human)
RP033217 100 ug Ask for price
TSPAN9 Recombinant Protein (Mouse)
RP181835 100 ug Ask for price
TSPAN9 Recombinant Protein (Rat)
RP235037 100 ug Ask for price
Tetraspanin 9 (TSPAN9) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tetraspanin 9 (TSPAN9) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tetraspanin 9 (TSPAN9) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TSPAN9 Polyclonal Antibody, HRP Conjugated
A68740 100 ?g
EUR 628.55
Description: reagents widely cited
TSPAN9 Polyclonal Antibody, FITC Conjugated
A68741 100 ?g
EUR 628.55
Description: Ask the seller for details
TSPAN9 Polyclonal Antibody, Biotin Conjugated
A68742 100 ?g
EUR 628.55
Description: The best epigenetics products
TSPAN9 ORF Vector (Human) (pORF)
ORF011073 1.0 ug DNA
EUR 95
Tspan9 ORF Vector (Mouse) (pORF)
ORF060613 1.0 ug DNA
EUR 506
Tspan9 ORF Vector (Rat) (pORF)
ORF078347 1.0 ug DNA
EUR 506
Human Tetraspanin 9(TSPAN9)ELISA Kit
QY-E01380 96T
EUR 361
Porcine Tetraspanin- 9, TSPAN9 ELISA KIT
ELI-36560p 96 Tests
EUR 928
Mouse Tetraspanin- 9, Tspan9 ELISA KIT
ELI-17929m 96 Tests
EUR 865
Human Tetraspanin- 9, TSPAN9 ELISA KIT
ELI-40370h 96 Tests
EUR 824
TSPAN9 sgRNA CRISPR Lentivector set (Human)
K2541901 3 x 1.0 ug
EUR 339
Tspan9 sgRNA CRISPR Lentivector set (Rat)
K6119701 3 x 1.0 ug
EUR 339
Tspan9 sgRNA CRISPR Lentivector set (Mouse)
K4751301 3 x 1.0 ug
EUR 339
TSPAN9-IT1 ORF Vector (Human) (pORF)
ORF035192 1.0 ug DNA Ask for price
Canine C-Peptide ELISA Kit
RD-C-Peptide-c-48Tests 48 Tests
EUR 533
Canine C-Peptide ELISA Kit
RD-C-Peptide-c-96Tests 96 Tests
EUR 740
Human C-Peptide ELISA Kit
RD-C-Peptide-Hu-48Tests 48 Tests
EUR 387
Human C-Peptide ELISA Kit
RD-C-Peptide-Hu-96Tests 96 Tests
EUR 532
Mouse C-Peptide ELISA Kit
RD-C-Peptide-Mu-48Tests 48 Tests
EUR 446
Mouse C-Peptide ELISA Kit
RD-C-Peptide-Mu-96Tests 96 Tests
EUR 615
Rat C-Peptide ELISA Kit
RD-C-Peptide-Ra-48Tests 48 Tests
EUR 465
Rat C-Peptide ELISA Kit
RD-C-Peptide-Ra-96Tests 96 Tests
EUR 643
Canine C-Peptide ELISA Kit
DLR-C-Peptide-c-48T 48T
EUR 527
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Canine C-Peptide ELISA Kit
DLR-C-Peptide-c-96T 96T
EUR 688
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human C-Peptide ELISA Kit
DLR-C-Peptide-Hu-48T 48T
EUR 398
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human C-Peptide ELISA Kit
DLR-C-Peptide-Hu-96T 96T
EUR 511
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse C-Peptide ELISA Kit
DLR-C-Peptide-Mu-48T 48T
EUR 450
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse C-Peptide ELISA Kit
DLR-C-Peptide-Mu-96T 96T
EUR 582
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat C-Peptide ELISA Kit
DLR-C-Peptide-Ra-48T 48T
EUR 467
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat C-Peptide ELISA Kit
DLR-C-Peptide-Ra-96T 96T
EUR 605
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Canine C-Peptide ELISA Kit
RDR-C-Peptide-c-48Tests 48 Tests
EUR 557
Canine C-Peptide ELISA Kit
RDR-C-Peptide-c-96Tests 96 Tests
EUR 774
Human C-Peptide ELISA Kit
RDR-C-Peptide-Hu-48Tests 48 Tests
EUR 404
Human C-Peptide ELISA Kit
RDR-C-Peptide-Hu-96Tests 96 Tests
EUR 556
Mouse C-Peptide ELISA Kit
RDR-C-Peptide-Mu-48Tests 48 Tests
EUR 465
Mouse C-Peptide ELISA Kit
RDR-C-Peptide-Mu-96Tests 96 Tests
EUR 643
Rat C-Peptide ELISA Kit
RDR-C-Peptide-Ra-48Tests 48 Tests
EUR 486
Rat C-Peptide ELISA Kit
RDR-C-Peptide-Ra-96Tests 96 Tests
EUR 672
TSPAN9 sgRNA CRISPR Lentivector (Human) (Target 1)
K2541902 1.0 ug DNA
EUR 154
TSPAN9 sgRNA CRISPR Lentivector (Human) (Target 2)
K2541903 1.0 ug DNA
EUR 154
TSPAN9 sgRNA CRISPR Lentivector (Human) (Target 3)
K2541904 1.0 ug DNA
EUR 154
Tspan9 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6119702 1.0 ug DNA
EUR 154
Tspan9 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6119703 1.0 ug DNA
EUR 154
Tspan9 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6119704 1.0 ug DNA
EUR 154
Tspan9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4751302 1.0 ug DNA
EUR 154
Tspan9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4751303 1.0 ug DNA
EUR 154
Tspan9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4751304 1.0 ug DNA
EUR 154
TSPAN9 3'UTR GFP Stable Cell Line
TU077318 1.0 ml
EUR 2333
TSPAN9 Protein Vector (Rat) (pPB-C-His)
PV313386 500 ng
EUR 603
TSPAN9 Protein Vector (Rat) (pPB-N-His)
PV313387 500 ng
EUR 603
TSPAN9 Protein Vector (Rat) (pPM-C-HA)
PV313388 500 ng
EUR 603
TSPAN9 Protein Vector (Rat) (pPM-C-His)
PV313389 500 ng
EUR 603
TSPAN9 Protein Vector (Human) (pPB-C-His)
PV044289 500 ng
EUR 329
TSPAN9 Protein Vector (Human) (pPB-N-His)
PV044290 500 ng
EUR 329
TSPAN9 Protein Vector (Human) (pPM-C-HA)
PV044291 500 ng
EUR 329
TSPAN9 Protein Vector (Human) (pPM-C-His)
PV044292 500 ng
EUR 329
TSPAN9 Protein Vector (Mouse) (pPB-C-His)
PV242450 500 ng
EUR 603
TSPAN9 Protein Vector (Mouse) (pPB-N-His)
PV242451 500 ng
EUR 603
TSPAN9 Protein Vector (Mouse) (pPM-C-HA)
PV242452 500 ng
EUR 603
TSPAN9 Protein Vector (Mouse) (pPM-C-His)
PV242453 500 ng
EUR 603
Tspan9 3'UTR Luciferase Stable Cell Line
TU222567 1.0 ml Ask for price
Tspan9 3'UTR GFP Stable Cell Line
TU171255 1.0 ml Ask for price
Tspan9 3'UTR GFP Stable Cell Line
TU272567 1.0 ml Ask for price
TSPAN9 3'UTR Luciferase Stable Cell Line
TU027318 1.0 ml
EUR 2333
Tspan9 3'UTR Luciferase Stable Cell Line
TU121255 1.0 ml Ask for price
TSPAN9-IT1 Protein Vector (Human) (pPB-C-His)
PV140766 500 ng Ask for price
TSPAN9-IT1 Protein Vector (Human) (pPB-N-His)
PV140767 500 ng Ask for price
TSPAN9-IT1 Protein Vector (Human) (pPM-C-HA)
PV140768 500 ng Ask for price
TSPAN9-IT1 Protein Vector (Human) (pPM-C-His)
PV140769 500 ng Ask for price
TSPAN9-IT1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV754673 1.0 ug DNA Ask for price

Conclusions: Evaluation have to be tailored to the training aims, and blueprints enhance content material validity.