MYBPHL Antibody
42913-100ul	SAB	100ul	EUR 302.4

Human IgG antibody Laboratories manufactures the mybiosource mybphl antikörper reagents distributed by Genprice. The Mybiosource Mybphl Antikörper reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact MyBiosource Eur. Other Mybiosource products are available in stock. Specificity: Mybiosource Category: Mybphl Group: Antikörper

MYBPHL Antibody
EnoGene	100ug/200ul	EUR 295
Description: Available in various conjugation types.

Mybphl/ Rat Mybphl ELISA Kit
Lifescience Market	96 Tests	EUR 1063.2

MYBPHL Conjugated Antibody
SAB	100ul	EUR 476.4

MYBPHL siRNA
Abbexa	EUR 661.2 EUR 878.4	15 nmol 30 nmol
Shipped within 5-10 working days.

MYBPHL siRNA
Abbexa	EUR 661.2 EUR 878.4	15 nmol 30 nmol
Shipped within 5-10 working days.

MYBPHL siRNA
Abbexa	EUR 661.2 EUR 878.4	15 nmol 30 nmol
Shipped within 5-10 working days.

Human MYBPHL shRNA Plasmid
Abbexa	EUR 961.2 EUR 1345.2	150 µg 300 µg
Shipped within 15-20 working days.

Antikörper information

MYBPHL cloning plasmid
CSB-CL015269HU1-10ug	Cusabio	10ug	EUR 279.6
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1065 Sequence: atggaggcagccacagctccggaggtggccgcaggatccaagctgaaggtgaaagaagccagcccagcggatgctgaaccaccccaggcttcacctggacagggggctggcagccccactccccagctcctgccccctatagaagagcaccccaagatctggctacctcgggccc Show more
Description: A cloning plasmid for the MYBPHL gene.

MYBPHL cloning plasmid
CSB-CL015269HU2-10ug	Cusabio	10ug	EUR 279.6
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1065 Sequence: atggaggcagccacagctccggaggtggccgcaggatccaagctgaaggtgaaagaagccagcccagcggatgctgaaccaccccaggcttcacctggacagggggctggcagccccactccccagctcctgccccctatagaagagcaccccaagatctggctacctcgggccc Show more
Description: A cloning plasmid for the MYBPHL gene.

Rat MYBPHL shRNA Plasmid
20-abx989632	Abbexa	EUR 961.2 EUR 1345.2	150 µg 300 µg
Shipped within 15-20 working days.

Mouse MYBPHL shRNA Plasmid
20-abx976726	Abbexa	EUR 961.2 EUR 1345.2	150 µg 300 µg
Shipped within 15-20 working days.

Human MYBPHL shRNA Plasmid
20-abx967428	Abbexa	EUR 961.2 EUR 1345.2	150 µg 300 µg
Shipped within 15-20 working days.

Mybphl ORF Vector (Rat) (pORF)
ORF070961	ABM	1.0 ug DNA	EUR 607.2

MYBPHL Recombinant Protein (Rat)
RP212879	ABM	100 ug	Ask for price

MYBPHL ORF Vector (Human) (pORF)
ORF013837	ABM	1.0 ug DNA	EUR 424.8

MYBPHL ORF Vector (Human) (pORF)
ORF013838	ABM	1.0 ug DNA	EUR 424.8

Mybphl ORF Vector (Mouse) (pORF)
ORF050830	ABM	1.0 ug DNA	EUR 607.2

Myosin-Binding Protein H-Like (MYBPHL) Antibody
abx026464-400ul	Abbexa	400 ul	EUR 627.6
Shipped within 5-10 working days.

Myosin-Binding Protein H-Like (MYBPHL) Antibody
abx026464-80l	Abbexa	80 µl	EUR 343.2
Shipped within 5-10 working days.

Myosin-Binding Protein H-Like (MYBPHL) Antibody
abx048493-100ug	Abbexa	100 ug	EUR 469.2
Shipped within 5-10 working days.

MYBPHL Recombinant Protein (Mouse)
RP152486	ABM	100 ug	Ask for price

MYBPHL Recombinant Protein (Human)
RP041509	ABM	100 ug	Ask for price

MYBPHL Recombinant Protein (Human)
RP041512	ABM	100 ug	Ask for price

Human MYBPHL Protein Lysate 20ug
IHUMYBPHLPLLY20UG	Innovative research	each	EUR 213
Wet Ice
Description: Human MYBPHL Protein Lysate 20ug