Mybiosource Mybphl Antikörper

MYBPHL Antibody

42913-100ul 100ul
EUR 302.4

Human IgG antibody Laboratories manufactures the mybiosource mybphl antikörper reagents distributed by Genprice. The Mybiosource Mybphl Antikörper reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact MyBiosource Eur. Other Mybiosource products are available in stock. Specificity: Mybiosource Category: Mybphl Group: Antikörper

MYBPHL Antibody

100ug/200ul
EUR 295
Description: Available in various conjugation types.

Mybphl/ Rat Mybphl ELISA Kit

96 Tests
EUR 1063.2

MYBPHL Conjugated Antibody

100ul
EUR 476.4

MYBPHL siRNA

  • EUR 661.2
  • EUR 878.4
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MYBPHL siRNA

  • EUR 661.2
  • EUR 878.4
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MYBPHL siRNA

  • EUR 661.2
  • EUR 878.4
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human MYBPHL shRNA Plasmid

  • EUR 961.2
  • EUR 1345.2
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Antikörper information

MYBPHL cloning plasmid

CSB-CL015269HU1-10ug 10ug
EUR 279.6
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1065
  • Sequence: atggaggcagccacagctccggaggtggccgcaggatccaagctgaaggtgaaagaagccagcccagcggatgctgaaccaccccaggcttcacctggacagggggctggcagccccactccccagctcctgccccctatagaagagcaccccaagatctggctacctcgggccc
  • Show more
Description: A cloning plasmid for the MYBPHL gene.

MYBPHL cloning plasmid

CSB-CL015269HU2-10ug 10ug
EUR 279.6
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1065
  • Sequence: atggaggcagccacagctccggaggtggccgcaggatccaagctgaaggtgaaagaagccagcccagcggatgctgaaccaccccaggcttcacctggacagggggctggcagccccactccccagctcctgccccctatagaagagcaccccaagatctggctacctcgggccc
  • Show more
Description: A cloning plasmid for the MYBPHL gene.

Rat MYBPHL shRNA Plasmid

20-abx989632
  • EUR 961.2
  • EUR 1345.2
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MYBPHL shRNA Plasmid

20-abx976726
  • EUR 961.2
  • EUR 1345.2
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MYBPHL shRNA Plasmid

20-abx967428
  • EUR 961.2
  • EUR 1345.2
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mybphl ORF Vector (Rat) (pORF)

ORF070961 1.0 ug DNA
EUR 607.2

MYBPHL Recombinant Protein (Rat)

RP212879 100 ug Ask for price

MYBPHL ORF Vector (Human) (pORF)

ORF013837 1.0 ug DNA
EUR 424.8

MYBPHL ORF Vector (Human) (pORF)

ORF013838 1.0 ug DNA
EUR 424.8

Mybphl ORF Vector (Mouse) (pORF)

ORF050830 1.0 ug DNA
EUR 607.2

Myosin-Binding Protein H-Like (MYBPHL) Antibody

abx026464-400ul 400 ul
EUR 627.6
  • Shipped within 5-10 working days.

Myosin-Binding Protein H-Like (MYBPHL) Antibody

abx026464-80l 80 µl
EUR 343.2
  • Shipped within 5-10 working days.

Myosin-Binding Protein H-Like (MYBPHL) Antibody

abx048493-100ug 100 ug
EUR 469.2
  • Shipped within 5-10 working days.

MYBPHL Recombinant Protein (Mouse)

RP152486 100 ug Ask for price

MYBPHL Recombinant Protein (Human)

RP041509 100 ug Ask for price

MYBPHL Recombinant Protein (Human)

RP041512 100 ug Ask for price

Human MYBPHL Protein Lysate 20ug

IHUMYBPHLPLLY20UG each
EUR 213
  • Wet Ice
Description: Human MYBPHL Protein Lysate 20ug