|
42913-100ul |
SAB |
100ul |
EUR 302.4 |
Human IgG antibody Laboratories manufactures the mybiosource mybphl antikörper reagents distributed by Genprice. The Mybiosource Mybphl Antikörper reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact MyBiosource Eur. Other Mybiosource products are available in stock. Specificity: Mybiosource Category: Mybphl Group: Antikörper
MYBPHL Antibody |
EnoGene |
100ug/200ul |
EUR 295 |
Description: Available in various conjugation types. |
MYBPHL Conjugated Antibody |
SAB |
100ul |
EUR 476.4 |
MYBPHL siRNA |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MYBPHL siRNA |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MYBPHL siRNA |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human MYBPHL shRNA Plasmid |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Antikörper information
MYBPHL cloning plasmid |
CSB-CL015269HU1-10ug |
Cusabio |
10ug |
EUR 279.6 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1065
- Sequence: atggaggcagccacagctccggaggtggccgcaggatccaagctgaaggtgaaagaagccagcccagcggatgctgaaccaccccaggcttcacctggacagggggctggcagccccactccccagctcctgccccctatagaagagcaccccaagatctggctacctcgggccc
- Show more
|
Description: A cloning plasmid for the MYBPHL gene. |
MYBPHL cloning plasmid |
CSB-CL015269HU2-10ug |
Cusabio |
10ug |
EUR 279.6 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1065
- Sequence: atggaggcagccacagctccggaggtggccgcaggatccaagctgaaggtgaaagaagccagcccagcggatgctgaaccaccccaggcttcacctggacagggggctggcagccccactccccagctcctgccccctatagaagagcaccccaagatctggctacctcgggccc
- Show more
|
Description: A cloning plasmid for the MYBPHL gene. |
Rat MYBPHL shRNA Plasmid |
20-abx989632 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse MYBPHL shRNA Plasmid |
20-abx976726 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MYBPHL shRNA Plasmid |
20-abx967428 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mybphl ORF Vector (Rat) (pORF) |
ORF070961 |
ABM |
1.0 ug DNA |
EUR 607.2 |
MYBPHL Recombinant Protein (Rat) |
RP212879 |
ABM |
100 ug |
Ask for price |
MYBPHL ORF Vector (Human) (pORF) |
ORF013837 |
ABM |
1.0 ug DNA |
EUR 424.8 |
MYBPHL ORF Vector (Human) (pORF) |
ORF013838 |
ABM |
1.0 ug DNA |
EUR 424.8 |
Mybphl ORF Vector (Mouse) (pORF) |
ORF050830 |
ABM |
1.0 ug DNA |
EUR 607.2 |
Myosin-Binding Protein H-Like (MYBPHL) Antibody |
abx026464-400ul |
Abbexa |
400 ul |
EUR 627.6 |
- Shipped within 5-10 working days.
|
Myosin-Binding Protein H-Like (MYBPHL) Antibody |
abx026464-80l |
Abbexa |
80 µl |
EUR 343.2 |
- Shipped within 5-10 working days.
|
Myosin-Binding Protein H-Like (MYBPHL) Antibody |
abx048493-100ug |
Abbexa |
100 ug |
EUR 469.2 |
- Shipped within 5-10 working days.
|
MYBPHL Recombinant Protein (Mouse) |
RP152486 |
ABM |
100 ug |
Ask for price |
MYBPHL Recombinant Protein (Human) |
RP041509 |
ABM |
100 ug |
Ask for price |
MYBPHL Recombinant Protein (Human) |
RP041512 |
ABM |
100 ug |
Ask for price |
Human MYBPHL Protein Lysate 20ug |
IHUMYBPHLPLLY20UG |
Innovative research |
each |
EUR 213 |
|
Description: Human MYBPHL Protein Lysate 20ug |