Lab Reagents
Drosophila Antibody Laboratories manufactures the drosophila antibody anti-lsm11 reagents distributed by Genprice. The Drosophila Antibody Anti-Lsm11 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact drosophila Antibody. Other Drosophila products are available in stock. Specificity: Drosophila Category: Antibody Group: Anti-Lsm11
Anti-Lsm11 information
LSM11, U7 Small Nuclear RNA Associated (LSm11) Antibody |
20-abx141996 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
LSM11, U7 Small Nuclear RNA Associated (LSM11) Antibody |
abx234872-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
LSM11 siRNA |
20-abx923044 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LSM11 siRNA |
20-abx923045 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LSM11 Antibody, HRP conjugated |
1-CSB-PA013201LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LSM11. Recognizes LSM11 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
LSM11 Antibody, FITC conjugated |
1-CSB-PA013201LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LSM11. Recognizes LSM11 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
LSM11 Antibody, Biotin conjugated |
1-CSB-PA013201LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LSM11. Recognizes LSM11 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Drosophila Parkin Antibody |
abx025068-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Drosophila Parkin Antibody |
abx025068-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
LSM11 cloning plasmid |
CSB-CL013201HU-10ug |
Cusabio |
10ug |
EUR 413 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1083
- Sequence: atggaggagcgggagcggggggcgaggtcggctggcgccgggagccccgcgcgcccgcccagcccgcggctggatgtcagctctgacagcttcgacccgctgctggccctgtacgcgccccgcctgcctcccattccctaccccaatgccccctgcttcaacaacgtggcggagt
- Show more
|
Description: A cloning plasmid for the LSM11 gene. |
LSM11 Rabbit pAb |
A7516-100ul |
Abclonal |
100 ul |
EUR 308 |
LSM11 Rabbit pAb |
A7516-200ul |
Abclonal |
200 ul |
EUR 459 |
LSM11 Rabbit pAb |
A7516-20ul |
Abclonal |
20 ul |
EUR 183 |