Drosophila Antibody Anti-Lsm11

Lab Reagents

Drosophila Antibody Laboratories manufactures the drosophila antibody anti-lsm11 reagents distributed by Genprice. The Drosophila Antibody Anti-Lsm11 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact drosophila Antibody. Other Drosophila products are available in stock. Specificity: Drosophila Category: Antibody Group: Anti-Lsm11

Anti-Lsm11 information

LSM11, U7 Small Nuclear RNA Associated (LSm11) Antibody

20-abx141996
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

LSM11, U7 Small Nuclear RNA Associated (LSM11) Antibody

abx234872-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

LSM11 siRNA

20-abx923044
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LSM11 siRNA

20-abx923045
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LSM11 Antibody, HRP conjugated

1-CSB-PA013201LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSM11. Recognizes LSM11 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LSM11 Antibody, FITC conjugated

1-CSB-PA013201LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSM11. Recognizes LSM11 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LSM11 Antibody, Biotin conjugated

1-CSB-PA013201LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSM11. Recognizes LSM11 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-mei-41 (Drosophila melanogaster) antibody

STJ72762 100 µg
EUR 260

Anti-cutoff / cuff (Drosophila melanogaster) antibody

STJ72763 100 µg
EUR 260

Anti-lava lamp (Drosophila melanogaster) antibody

STJ72772 100 µg
EUR 359

Anti-E2F1 (Drosophila, aa480-493) antibody

STJ72874 100 µg
EUR 359

Drosophila Parkin Antibody

abx025068-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Drosophila Parkin Antibody

abx025068-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

LSM11 cloning plasmid

CSB-CL013201HU-10ug 10ug
EUR 413
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: atggaggagcgggagcggggggcgaggtcggctggcgccgggagccccgcgcgcccgcccagcccgcggctggatgtcagctctgacagcttcgacccgctgctggccctgtacgcgccccgcctgcctcccattccctaccccaatgccccctgcttcaacaacgtggcggagt
  • Show more
Description: A cloning plasmid for the LSM11 gene.

LSM11 Rabbit pAb

A7516-100ul 100 ul
EUR 308

LSM11 Rabbit pAb

A7516-200ul 200 ul
EUR 459

LSM11 Rabbit pAb

A7516-20ul 20 ul
EUR 183