Lab Reagents

Drosophila Antibody Laboratories manufactures the drosophila antibody anti-lsm11 reagents distributed by Genprice. The Drosophila Antibody Anti-Lsm11 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact drosophila Antibody. Other Drosophila products are available in stock. Specificity: Drosophila Category: Antibody Group: Anti-Lsm11

Anti-Lsm11 information

LSM11, U7 Small Nuclear RNA Associated (LSm11) Antibody
20-abx141996	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

LSM11, U7 Small Nuclear RNA Associated (LSM11) Antibody
abx234872-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

LSM11 siRNA
20-abx923044	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LSM11 siRNA
20-abx923045	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LSM11 Antibody, HRP conjugated
1-CSB-PA013201LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSM11. Recognizes LSM11 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LSM11 Antibody, FITC conjugated
1-CSB-PA013201LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSM11. Recognizes LSM11 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LSM11 Antibody, Biotin conjugated
1-CSB-PA013201LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSM11. Recognizes LSM11 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-mei-41 (Drosophila melanogaster) antibody
STJ72762	St John's Laboratory	100 µg	EUR 260

Anti-cutoff / cuff (Drosophila melanogaster) antibody
STJ72763	St John's Laboratory	100 µg	EUR 260

Anti-lava lamp (Drosophila melanogaster) antibody
STJ72772	St John's Laboratory	100 µg	EUR 359

Anti-E2F1 (Drosophila, aa480-493) antibody
STJ72874	St John's Laboratory	100 µg	EUR 359

Drosophila Parkin Antibody
abx025068-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Drosophila Parkin Antibody
abx025068-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

LSM11 cloning plasmid
CSB-CL013201HU-10ug	Cusabio	10ug	EUR 413
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1083 Sequence: atggaggagcgggagcggggggcgaggtcggctggcgccgggagccccgcgcgcccgcccagcccgcggctggatgtcagctctgacagcttcgacccgctgctggccctgtacgcgccccgcctgcctcccattccctaccccaatgccccctgcttcaacaacgtggcggagt Show more
Description: A cloning plasmid for the LSM11 gene.

LSM11 Rabbit pAb
A7516-100ul	Abclonal	100 ul	EUR 308

LSM11 Rabbit pAb
A7516-200ul	Abclonal	200 ul	EUR 459

LSM11 Rabbit pAb
A7516-20ul	Abclonal	20 ul	EUR 183