An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database.

microbiologystudents

An technique to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database.

A method to correlate the uninterpreted tandem mass spectra of peptides produced beneath low vitality (10-50 eV) collision circumstances with amino acid sequences throughout the Genpept database has been developed. On this system the protein database is searched to find out linear amino acid sequences inside a mass tolerance of ±1 u of the precursor ion molecular weight A cross-correlation function is then used to produce a measurement of similarity between the mass-to-charge ratios for the fragment ions predicted from amino acid sequences obtained from the database and the fragment ions seen throughout the tandem mass spectrum.

 

Usually, a distinction larger than 0.1 between the normalized cross-correlation options of the first- and second-ranked search outcomes signifies a worthwhile match between sequence and spectrum. Searches of species-specific protein databases with tandem mass spectra acquired from peptides obtained from the enzymatically digested complete proteins of E. coli and S.

 

cerevisiae cells allowed matching of the spectra to amino acid sequences inside proteins of these organisms. The technique described on this manuscript offers a useful methodology to interpret tandem mass spectra with acknowledged sequences in a protein database.

 

UHRF1BP1L Peptide

MBS152886-5x005mg 5x0.05mg
EUR 770

UHRF1BP1L Antibody (Center) Blocking Peptide

MBS9221797-INQUIRE INQUIRE Ask for price

UHRF1BP1L

CSB-CL025606HU1 10 μg plasmid + 200μl Glycerol Ask for price

UHRF1BP1L

CSB-CL025606HU2 10 μg plasmid + 200μl Glycerol Ask for price

UHRF1BP1L

MBS8564336-01mLAF405L 0.1mL(AF405L)
EUR 565

UHRF1BP1L

MBS8564336-01mLAF405S 0.1mL(AF405S)
EUR 565

UHRF1BP1L

MBS8564336-01mLAF610 0.1mL(AF610)
EUR 565

UHRF1BP1L

MBS8564336-01mLAF635 0.1mL(AF635)
EUR 565

UHRF1BP1L

MBS8564336-02mL 0.2mL
EUR 345

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like)

MBS6012429-02mL 0.2(mL
EUR 695

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like)

MBS6012429-5x02mL 5x0.2mL
EUR 2975

UHRF1BP1L Antibody

6461-002mg 0.02 mg
EUR 206.18
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: UHRF1BP1L Antibody: The Ubiquitin-like containing PHD and RING finger domains 1-binding protein 1-like (UHRF1BP1L) is closely related to UHRF1BP1, also known as ICBP90, a transcription and cell cycle regulator that specifically binds to the histone H3 N-terminal tail. While little is known of UHRF1BP1L, UHRF1BP1 is required for proper heterochromatin formation in mammalian cells. Furthermore, UHRF1BP1 is thought to be a pivotal target for the ERK1/2 signaling pathway to control the proliferation of Jurkat T cells, suggesting that UHRF1BP1L may also be involved in chromatin regulation and cell proliferation.

UHRF1BP1L Antibody

6461-01mg 0.1 mg
EUR 523.7
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: UHRF1BP1L Antibody: The Ubiquitin-like containing PHD and RING finger domains 1-binding protein 1-like (UHRF1BP1L) is closely related to UHRF1BP1, also known as ICBP90, a transcription and cell cycle regulator that specifically binds to the histone H3 N-terminal tail. While little is known of UHRF1BP1L, UHRF1BP1 is required for proper heterochromatin formation in mammalian cells. Furthermore, UHRF1BP1 is thought to be a pivotal target for the ERK1/2 signaling pathway to control the proliferation of Jurkat T cells, suggesting that UHRF1BP1L may also be involved in chromatin regulation and cell proliferation.

UHRF1BP1L Antibody

25349-100ul 100ul
EUR 468

UHRF1BP1L Antibody

1-CSB-PA025606LA01HU
  • Ask for price
  • Ask for price
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is Unconjugated. Tested in the following application: ELISA

UHRF1BP1L Antibody

E312594 200ul
EUR 275
Description: Available in various conjugation types.

UHRF1BP1L Antibody

MBS1499178-005mg 0.05mg
EUR 190

UHRF1BP1L Antibody

MBS1499178-01mg 0.1mg
EUR 270

UHRF1BP1L Antibody

MBS1499178-5x01mg 5x0.1mg
EUR 1205

UHRF1BP1L Antibody

MBS150249-01mg 0.1mg
EUR 445

UHRF1BP1L Antibody

MBS150249-5x01mg 5x0.1mg
EUR 1965

UHRF1BP1L Antibody

MBS9401808-01mL 0.1mL
EUR 495

UHRF1BP1L Antibody

MBS9401808-5x01mL 5x0.1mL
EUR 2075

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (AP)

MBS6361256-02mL 0.2mL
EUR 980

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (AP)

MBS6361256-5x02mL 5x0.2mL
EUR 4250

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (PE)

MBS6361266-02mL 0.2mL
EUR 980

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (PE)

MBS6361266-5x02mL 5x0.2mL
EUR 4250

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (APC)

MBS6361257-02mL 0.2mL
EUR 980

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (APC)

MBS6361257-5x02mL 5x0.2mL
EUR 4250

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (FITC)

MBS6361259-02mL 0.2mL
EUR 980

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (FITC)

MBS6361259-5x02mL 5x0.2mL
EUR 4250

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (Biotin)

MBS6361258-02mL 0.2mL
EUR 980

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (Biotin)

MBS6361258-5x02mL 5x0.2mL
EUR 4250

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 405)

MBS6361261-01mL 0.1mL
EUR 980

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 405)

MBS6361261-5x01mL 5x0.1mL
EUR 4250

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 490)

MBS6361262-01mL 0.1mL
EUR 980

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 490)

MBS6361262-5x01mL 5x0.1mL
EUR 4250

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 550)

MBS6361263-01mL 0.1mL
EUR 980

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 550)

MBS6361263-5x01mL 5x0.1mL
EUR 4250

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 650)

MBS6361264-01mL 0.1mL
EUR 980

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 650)

MBS6361264-5x01mL 5x0.1mL
EUR 4250

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 750)

MBS6361265-01mL 0.1mL
EUR 980

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 750)

MBS6361265-5x01mL 5x0.1mL
EUR 4250

UHRF1BP1L cDNA Clone

MBS1272441-001mgPlasmid02mLGlycerolStock 0.01mgPlasmid+0.2mLGlycerol-Stock
EUR 330

UHRF1BP1L cDNA Clone

MBS1272441-5x001mgPlasmid5x02mLGlycerolStock 5x0.01mgPlasmid+5x0.2mLGlycerol-Stock
EUR 1430

UHRF1BP1L cDNA Clone

MBS1275299-001mgPlasmid02mLGlycerolStock 0.01mgPlasmid+0.2mLGlycerol-Stock
EUR 1065

UHRF1BP1L cDNA Clone

MBS1275299-5x001mgPlasmid5x02mLGlycerolStock 5x0.01mgPlasmid+5x0.2mLGlycerol-Stock
EUR 4745

Uhrf1bp1l (untagged) - Mouse UHRF1 (ICBP90) binding protein 1-like (Uhrf1bp1l), (10ug)

MC224500 10 µg Ask for price

Uhrf1bp1l (untagged ORF) - Rat UHRF1 binding protein 1-like (Uhrf1bp1l), (10 ug)

RN206432 10 µg Ask for price

Mouse UHRF1BP1L siRNA

20-abx938993
  • Ask for price
  • Ask for price
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human UHRF1BP1L siRNA

20-abx938994
  • Ask for price
  • Ask for price
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UHRF1BP1L siRNA (Human)

MBS827751-15nmol 15nmol
EUR 405

UHRF1BP1L siRNA (Human)

MBS827751-30nmol 30nmol
EUR 565

UHRF1BP1L siRNA (Human)

MBS827751-5x30nmol 5x30nmol
EUR 2450

UHRF1BP1L siRNA (Mouse)

MBS8229413-15nmol 15nmol
EUR 405

UHRF1BP1L siRNA (Mouse)

MBS8229413-30nmol 30nmol
EUR 565

UHRF1BP1L siRNA (Mouse)

MBS8229413-5x30nmol 5x30nmol
EUR 2450

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (Azide free) (HRP)

MBS6361260-02mL 0.2mL
EUR 980

UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (Azide free) (HRP)

MBS6361260-5x02mL 5x0.2mL
EUR 4250

anti- UHRF1BP1L antibody

FNab09246 100µg
EUR 702
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:500-1:5000
  • Immunogen: UHRF1 binding protein 1-like
  • Uniprot ID: A0JNW5
  • Gene ID: 23074
Description: Antibody raised against UHRF1BP1L

Uhrf1bp1l (Myc-DDK-tagged) - Mouse UHRF1 (ICBP90) binding protein 1-like (Uhrf1bp1l)

MR217370 10 µg Ask for price

Uhrf1bp1l (GFP-tagged) - Mouse UHRF1 (ICBP90) binding protein 1-like (Uhrf1bp1l), (10ug)

MG217370 10 µg Ask for price

UHRF1BP1L cloning plasmid

CSB-CL025606HU1-10ug 10ug
EUR 451.2
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1569
  • Sequence: atggccgggatcatcaagaaacaaatcttgaagcacctctccagatttaccaaaaatttatctcctgacaagataaatctaagtacccttaaaggagaaggtgaactgaagaatttggagttggatgaagaagtactccagaatatgttggatttgccaacatggcttgctatca
  • Show more
Description: A cloning plasmid for the UHRF1BP1L gene.

UHRF1BP1L cloning plasmid

CSB-CL025606HU2-10ug 10ug
EUR 1308
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3033
  • Sequence: ATGGCCGGGATCATCAAGAAACAAATCTTGAAGCACCTCTCCAGATTTACCAAAAATTTATCTCCTGACAAGATAAATCTAAGTACCCTTAAAGGAGAAGGTGAACTGAAGAATTTGGAGTTGGATGAAGAAGTACTCCAGAATATGTTGGATTTGCCAACATGGCTTGCTATCA
  • Show more
Description: A cloning plasmid for the UHRF1BP1L gene.

UHRF1BP1L Antibody (Center)

MBS9201066-008mL 0.08mL
EUR 210

UHRF1BP1L Antibody (Center)

MBS9201066-04mL 0.4mL
EUR 430

UHRF1BP1L Antibody (Center)

MBS9201066-5x04mL 5x0.4mL
EUR 1910

UHRF1BP1L (untagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 1

SC304212 10 µg Ask for price

UHRF1BP1L (untagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 2

SC301130 10 µg Ask for price

Uhrf1bp1l (Myc-DDK-tagged ORF) - Rat UHRF1 binding protein 1-like (Uhrf1bp1l), (10 ug)

RR206432 10 µg Ask for price

UHRF1BP1L Polyclonal Antibody

A61674
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 µg
  • 20 ul
  • 50 ul
  • 100 ul

Polyclonal UHRF1BP1L Antibody

APR06720G 0.1 mg
EUR 790.8
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UHRF1BP1L . This antibody is tested and proven to work in the following applications:

UHRF1BP1L ELISA KIT|Human

EF004066 96 Tests
EUR 826.8

UHRF1BP1L (GFP-tagged) - Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 1

RG217227 10 µg Ask for price

UHRF1BP1L (GFP-tagged) - Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 2

RG221416 10 µg Ask for price

Mouse UHRF1BP1L shRNA Plasmid

20-abx978348
  • Ask for price
  • Ask for price
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human UHRF1BP1L shRNA Plasmid

20-abx957978
  • Ask for price
  • Ask for price
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UHRF1BP1L (Myc-DDK-tagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 2

RC221416 10 µg Ask for price

UHRF1BP1L (Myc-DDK-tagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 1

RC217227 10 µg Ask for price

Lenti ORF clone of Uhrf1bp1l (mGFP-tagged) - Mouse UHRF1 (ICBP90) binding protein 1-like (Uhrf1bp1l)

MR217370L4 10 µg Ask for price

Uhrf1bp1l ORF Vector (Rat) (pORF)

ORF078615 1.0 ug DNA
EUR 2496

UHRF1BP1L Antibody, HRP conjugated

1-CSB-PA025606LB01HU
  • Ask for price
  • Ask for price
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UHRF1BP1L Antibody, HRP conjugated

MBS1493197-005mg 0.05mg
EUR 190

UHRF1BP1L Antibody, HRP conjugated

MBS1493197-01mg 0.1mg
EUR 270

UHRF1BP1L Antibody, HRP conjugated

MBS1493197-5x01mg 5x0.1mg
EUR 1205

UHRF1BP1L Antibody, FITC conjugated

1-CSB-PA025606LC01HU
  • Ask for price
  • Ask for price
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UHRF1BP1L Antibody, FITC conjugated

MBS1493816-005mg 0.05mg
EUR 190

 

CHARMM: the biomolecular simulation program.

CHARMM (Chemistry at HARvard Molecular Mechanics) is a extraordinarily versatile and broadly used molecular simulation program.

It has been developed over the previous three a few years with a primary give consideration to molecules of natural curiosity, along with proteins, peptides, lipids, nucleic acids, carbohydrates, and small molecule ligands, as they occur in reply, crystals, and membrane environments.

For the look at of such methods, this method offers a giant suite of computational devices that embrace fairly just a few conformational and path sampling methods, free vitality estimators, molecular minimization, dynamics, and analysis strategies, and model-building capabilities.

The CHARMM program is related to points involving a a lot wider class of many-particle methods.

Calculations with CHARMM could also be carried out using numerous fully totally different vitality options and fashions, from blended quantum mechanical-molecular mechanical stress fields, to all-atom classical potential vitality options with particular solvent and quite a few boundary circumstances, to implicit solvent and membrane fashions.

This method has been ported to fairly just a few platforms in every serial and parallel architectures. This textual content offers an overview of this method as a result of it exists within the current day with an emphasis on developments as a result of the publication of the distinctive CHARMM article in 1983.

 

Ghrelin is a growth-hormone-releasing acylated peptide from stomach.

 

Small synthetic molecules often known as growth-hormone secretagogues (GHSs) stimulate the discharge of improvement hormone (GH) from the pituitary. They act by means of GHS-R, a G-protein-coupled receptor for which the ligand is unknown.

Present cloning of GHS-R strongly implies that an endogenous ligand for the receptor does exist and that there is a mechanism for regulating GH launch that is distinct from its regulation by hypothalamic growth-hormone-releasing hormone (GHRH).

 

We now report the purification and identification in rat stomach of an endogenous ligand explicit for GHS-R.

The purified ligand is a peptide of 28 amino acids, by which the serine three residue is n-octanoylated. The acylated peptide notably releases GH every in vivo and in vitro, and O-n-octanoylation at serine three is essential for the train.

We designate the GH-releasing peptide ‘ghrelin’ (ghre is the Proto-Indo-European root of the phrase ‘develop’). Human ghrelin is homologous to rat ghrelin apart from two amino acids.

The incidence of ghrelin in every rat and human signifies that GH launch from the pituitary may be regulated not solely by hypothalamic GHRH, however as well as by ghrelin.

anti-Macrophage Inflammatory Protein 1

YF-PA14542 50 ug
EUR 435.6
Description: Mouse polyclonal to Macrophage Inflammatory Protein 1

Anti-Macrophage Inflammatory Protein 1 (4E7)

YF-MA10821 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage Inflammatory Protein 1

anti-Macrophage Inflammatory Protein 1 beta

YF-PA24669 50 ul
EUR 400.8
Description: Mouse polyclonal to Macrophage Inflammatory Protein 1 beta

anti-Macrophage Inflammatory Protein 1 beta

YF-PA14543 100 ug
EUR 483.6
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 1 beta

anti-Macrophage inflammatory protein 5

YF-PA24672 50 ul
EUR 400.8
Description: Mouse polyclonal to Macrophage inflammatory protein 5

anti-Macrophage Inflammatory Protein 4

YF-PA24674 50 ul
EUR 400.8
Description: Mouse polyclonal to Macrophage Inflammatory Protein 4

anti-Macrophage inflammatory protein 5

YF-PA20144 50 ug
EUR 435.6
Description: Mouse polyclonal to Macrophage inflammatory protein 5

anti-Macrophage inflammatory protein 5

YF-PA20145 100 ul
EUR 483.6
Description: Rabbit polyclonal to Macrophage inflammatory protein 5

anti-Macrophage inflammatory protein 5

YF-PA20146 100 ug
EUR 483.6
Description: Rabbit polyclonal to Macrophage inflammatory protein 5

anti-Macrophage inflammatory protein 5

YF-PA14551 100 ul
EUR 483.6
Description: Rabbit polyclonal to Macrophage inflammatory protein 5

anti-Macrophage inflammatory protein 5

YF-PA14552 100 ug
EUR 483.6
Description: Rabbit polyclonal to Macrophage inflammatory protein 5

anti-Macrophage Inflammatory Protein 4

YF-PA14553 100 ul
EUR 483.6
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 4

anti-Macrophage Inflammatory Protein 4

YF-PA14554 100 ug
EUR 483.6
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 4

anti-Macrophage Inflammatory Protein 3

YF-PA14559 50 ug
EUR 435.6
Description: Mouse polyclonal to Macrophage Inflammatory Protein 3

anti-Macrophage Inflammatory Protein 3

YF-PA14560 100 ul
EUR 483.6
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 3

anti-Macrophage Inflammatory Protein 3

YF-PA14561 100 ug
EUR 483.6
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 3

Anti-Macrophage Inflammatory Protein 1 beta antibody

MBS175746-01mg 0.1mg
EUR 450

Anti-Macrophage Inflammatory Protein 1 beta antibody

MBS175746-5x01mg 5x0.1mg
EUR 1870

Allograft inflammatory factor 1

AP78902 1mg
EUR 2640
  • E.coli

Allograft inflammatory factor 1

AP80262 1mg
EUR 2640
  • E.coli

Allograft inflammatory factor 1

AP80348 1mg
EUR 2640
  • E.coli

Allograft inflammatory factor 1

AP80350 1mg
EUR 2640
  • E.coli

Allograft inflammatory factor 1

AP80469 1mg
EUR 2640
  • E.coli

Anti-Macrophage inflammatory protein 5 (1D7)

YF-MA15363 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage inflammatory protein 5

Anti-Macrophage inflammatory protein 5 (3H1)

YF-MA15365 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage inflammatory protein 5

Anti-Macrophage inflammatory protein 5 (3B7)

YF-MA15366 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage inflammatory protein 5

Anti-Macrophage inflammatory protein 5 (3B1)

YF-MA15367 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage inflammatory protein 5

Anti-Macrophage Inflammatory Protein 4 (2C6)

YF-MA15369 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage Inflammatory Protein 4

Anti-Macrophage inflammatory protein 5 (3D3)

YF-MA19031 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage inflammatory protein 5

Anti-Macrophage Inflammatory Protein 1 beta/CCL4 Antibody

PA1379 100ug/vial
EUR 154
  • Mouse
Description: Western blot, 0.1-0.5μg/ml, Mouse

Anti-Macrophage inflammatory protein 5 (4G10)

YF-MA15364 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage inflammatory protein 5

Inflammatory profilin Antibody

abx110412-100l 100 µl
EUR 162.5

Inflammatory profilin Antibody

20-abx110412
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 20 ug
  • 50 ug
  • 100 ug
  • 200 ug
  • 1 mg
  • Shipped within 5-10 working days.

Anti-Macrophage Inflammatory Protein 1 alpha/CCL3 Mouse mAb

GB12687 100 μL
EUR 100

Anti- Macrophage Inflammatory Protein-1 Alpha (MIP-1 alpha) Antibody

GWB-464602 0.05 mg Ask for price
  • Anti- Macrophage Inflammatory Protein-1 Alpha (MIP-1 alpha) Antibody was previously known under catalogue number 18-251-404207 was previously known under catalogue number 18-251-404207

Anti-Macrophage Inflammatory Protein 3 beta (3E9)

YF-MA15370 200 ul
EUR 435.6
Description: Mouse monoclonal to Macrophage Inflammatory Protein 3 beta

ALLOGRAFT - INFLAMMATORY FACTOR-1 (AIF-1), Antibody

GWB-621C02 0.1 mg Ask for price

Anti-Macrophage Inflammatory Protein 1 alpha/CCL3 Rabbit pAb

GB111212 100 μL
EUR 100

Anti-Macrophage Inflammatory Protein 1 alpha/CCL3 Rabbit pAb

GB113793 100 μL
EUR 100

Anti-Macrophage Inflammatory Protein 1 alpha/CCL3 Rabbit pAb

GB11687 100 μL
EUR 100

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx002264-100l 100 µl
EUR 400

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx002264-20l 20 µl
EUR 175

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx002264-50l 50 µl
EUR 275

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx001285-100l 100 µl
EUR 400

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx001285
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 20 ul
  • 50 ul
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx001285-20l 20 µl
EUR 175

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx001285-50l 50 µl
EUR 275

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx025719-400l 400 µl
EUR 518.75

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx025719-400ul 400 ul
EUR 627.6
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx025719-80l 80 µl
EUR 281.25
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx037687-100ug 100 ug
EUR 469.2
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx037687-96tests 96 tests
EUR 337.5

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx037794-100ug 100 ug
EUR 469.2
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx037794-96tests 96 tests
EUR 337.5

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx109254-100l 100 µl
EUR 162.5

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx109254
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 20 ug
  • 50 ug
  • 100 ug
  • 200 ug
  • 1 mg
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx109516-100l 100 µl
EUR 162.5

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx109516
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 20 ug
  • 50 ug
  • 100 ug
  • 200 ug
  • 1 mg
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx110941-100l 100 µl
EUR 612.5

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx110941
  • Ask for price
  • Ask for price
  • 50 ul
  • 150 ul
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx131921-100g 100 µg
EUR 850

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx131921
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 20 ug
  • 50 ug
  • 100 ug
  • 200 ug
  • 1 mg
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx131921-20g 20 µg
EUR 375

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx131921-5g 5 µg
EUR 287.5

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx103213-100l 100 µl
EUR 225

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx103213
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 10 ug
  • 50 ug
  • 100 ug
  • 200 ug
  • 1 mg
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx103213-1ml 1 ml
EUR 525

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx103213-200l 200 µl
EUR 275

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx103214-100l 100 µl
EUR 237.5

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx103214
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 20 ug
  • 50 ug
  • 100 ug
  • 200 ug
  • 1 mg
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx103214-1ml 1 ml
EUR 625

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx103214-200l 200 µl
EUR 300

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx103215-100l 100 µl
EUR 275

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx103215
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 10 ug
  • 50 ug
  • 100 ug
  • 200 ug
  • 1 mg
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx103215-1ml 1 ml
EUR 775

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx103215-200l 200 µl
EUR 350

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx103216-100l 100 µl
EUR 287.5

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx103216
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 10 ug
  • 50 ug
  • 100 ug
  • 200 ug
  • 1 mg
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx103216-1ml 1 ml
EUR 812.5

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx103216-200l 200 µl
EUR 362.5

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx104925-100g 100 µg
EUR 850

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx104925
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 10 ug
  • 50 ug
  • 100 ug
  • 200 ug
  • 1 mg
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx104925-20g 20 µg
EUR 287.5

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx104925-50g 50 µg
EUR 375

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx175326
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 10 ug
  • 50 ug
  • 100 ug
  • 200 ug
  • 1 mg
  • Shipped within 5-12 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx175326-1096tests 10 × 96 tests
EUR 525

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx175326-596tests 5 × 96 tests
EUR 275

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx175326-96tests 96 tests
EUR 225

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx175327
  • Ask for price
  • Ask for price
  • 200 ug
  • 1 mg
  • Please enquire.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx147003-1096tests 10 × 96 tests Ask for price

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx147003-596tests 5 × 96 tests Ask for price

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx147003-96tests 96 tests
EUR 350

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx148081-1096tests 10 × 96 tests Ask for price

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx148081-596tests 5 × 96 tests
EUR 387.5

 

Leave A Comment