Posted in Antibodies, Assay Kits, Biology Cells, cDNA, Clia Kits, Culture Cells, Devices, DNA, DNA Templates, DNA Testing, Elisa Kits, Enzymes, Equipments, Exosomes, Gels, Isotypes, Medium & Serums, NATtrol, Panel, Particles, PCR, Pcr Kits, Peptides, Reagents, Recombinant Proteins, Ria Kits, RNA, Test Kits, Vector & Virus, Western Blot

An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database.

microbiologystudents

An technique to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database.

A method to correlate the uninterpreted tandem mass spectra of peptides produced beneath low vitality (10-50 eV) collision circumstances with amino acid sequences throughout the Genpept database has been developed. On this system the protein database is searched to find out linear amino acid sequences inside a mass tolerance of ±1 u of the precursor ion molecular weight A cross-correlation function is then used to produce a measurement of similarity between the mass-to-charge ratios for the fragment ions predicted from amino acid sequences obtained from the database and the fragment ions seen throughout the tandem mass spectrum.

 

Usually, a distinction larger than 0.1 between the normalized cross-correlation options of the first- and second-ranked search outcomes signifies a worthwhile match between sequence and spectrum. Searches of species-specific protein databases with tandem mass spectra acquired from peptides obtained from the enzymatically digested complete proteins of E. coli and S.

 

cerevisiae cells allowed matching of the spectra to amino acid sequences inside proteins of these organisms. The technique described on this manuscript offers a useful methodology to interpret tandem mass spectra with acknowledged sequences in a protein database.

 

UHRF1BP1L siRNA
20-abx938994
  • EUR 661.2
  • EUR 878.4
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UHRF1BP1L Antibody
25349-100ul 100ul
EUR 468

UHRF1BP1L Antibody
6461-002mg 0.02 mg
EUR 206.18
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: UHRF1BP1L Antibody: The Ubiquitin-like containing PHD and RING finger domains 1-binding protein 1-like (UHRF1BP1L) is closely related to UHRF1BP1, also known as ICBP90, a transcription and cell cycle regulator that specifically binds to the histone H3 N-terminal tail. While little is known of UHRF1BP1L, UHRF1BP1 is required for proper heterochromatin formation in mammalian cells. Furthermore, UHRF1BP1 is thought to be a pivotal target for the ERK1/2 signaling pathway to control the proliferation of Jurkat T cells, suggesting that UHRF1BP1L may also be involved in chromatin regulation and cell proliferation.

UHRF1BP1L Antibody
6461-01mg 0.1 mg
EUR 523.7
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: UHRF1BP1L Antibody: The Ubiquitin-like containing PHD and RING finger domains 1-binding protein 1-like (UHRF1BP1L) is closely related to UHRF1BP1, also known as ICBP90, a transcription and cell cycle regulator that specifically binds to the histone H3 N-terminal tail. While little is known of UHRF1BP1L, UHRF1BP1 is required for proper heterochromatin formation in mammalian cells. Furthermore, UHRF1BP1 is thought to be a pivotal target for the ERK1/2 signaling pathway to control the proliferation of Jurkat T cells, suggesting that UHRF1BP1L may also be involved in chromatin regulation and cell proliferation.

UHRF1BP1L Antibody
1-CSB-PA025606LA01HU
  • EUR 380.4
  • EUR 402
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is Unconjugated. Tested in the following application: ELISA

UHRF1BP1L Antibody
E312594 200ul
EUR 275
Description: Available in various conjugation types.

UHRF1BP1 Peptide
6459P 0.05 mg
EUR 197.7
Description: (IN) UHRF1BP1 peptide

anti- UHRF1BP1L antibody
FNab09246 100µg
EUR 702
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1：500-1：5000
  • Immunogen: UHRF1 binding protein 1-like
  • Uniprot ID: A0JNW5
  • Gene ID: 23074
Description: Antibody raised against UHRF1BP1L

UHRF1BP1L cloning plasmid
CSB-CL025606HU1-10ug 10ug
EUR 451.2
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1569
  • Sequence: atggccgggatcatcaagaaacaaatcttgaagcacctctccagatttaccaaaaatttatctcctgacaagataaatctaagtacccttaaaggagaaggtgaactgaagaatttggagttggatgaagaagtactccagaatatgttggatttgccaacatggcttgctatca
  • Show more
Description: A cloning plasmid for the UHRF1BP1L gene.

UHRF1BP1L cloning plasmid
CSB-CL025606HU2-10ug 10ug
EUR 1308
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3033
  • Sequence: ATGGCCGGGATCATCAAGAAACAAATCTTGAAGCACCTCTCCAGATTTACCAAAAATTTATCTCCTGACAAGATAAATCTAAGTACCCTTAAAGGAGAAGGTGAACTGAAGAATTTGGAGTTGGATGAAGAAGTACTCCAGAATATGTTGGATTTGCCAACATGGCTTGCTATCA
  • Show more
Description: A cloning plasmid for the UHRF1BP1L gene.

UHRF1BP1L ELISA KIT|Human
EF004066 96 Tests
EUR 826.8

Polyclonal UHRF1BP1L Antibody
APR06720G 0.1 mg
EUR 790.8
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UHRF1BP1L . This antibody is tested and proven to work in the following applications:

UHRF1BP1L Polyclonal Antibody
A61674
  • EUR 684.66
  • EUR 117.7
  • EUR 302.5
  • EUR 423.5
  • 100 µg
  • 20 ul
  • 50 ul
  • 100 ul

Human UHRF1BP1L shRNA Plasmid
20-abx957978
  • EUR 961.2
  • EUR 1345.2
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse UHRF1BP1L shRNA Plasmid
20-abx978348
  • EUR 961.2
  • EUR 1345.2
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Uhrf1bp1l ORF Vector (Rat) (pORF)
ORF078615 1.0 ug DNA
EUR 2496

UHRF1BP1L Antibody, HRP conjugated
1-CSB-PA025606LB01HU
  • EUR 380.4
  • EUR 402
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UHRF1BP1L ORF Vector (Human) (pORF)
ORF014885 1.0 ug DNA
EUR 424.8

UHRF1BP1L ORF Vector (Human) (pORF)
ORF011318 1.0 ug DNA
EUR 114

Uhrf1bp1l ORF Vector (Mouse) (pORF)
ORF061024 1.0 ug DNA
EUR 1886.4

UHRF1BP1L Antibody, FITC conjugated
1-CSB-PA025606LC01HU
  • EUR 380.4
  • EUR 402
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UHRF1BP1L Antibody, Biotin conjugated
1-CSB-PA025606LD01HU
  • EUR 380.4
  • EUR 402
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Uhrf1bp1l 3'UTR GFP Stable Cell Line
TU272852 1.0 ml Ask for price

UHRF1BP1L 3'UTR GFP Stable Cell Line
TU077815 1.0 ml
EUR 1672.8

Uhrf1bp1l 3'UTR GFP Stable Cell Line
TU171570 1.0 ml Ask for price

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody
abx239246-100ug 100 ug
EUR 661.2
  • Shipped within 5-12 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody
abx028888-400ul 400 ul
EUR 627.6
  • Shipped within 5-10 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody
abx028888-80l 80 µl
EUR 343.2
  • Shipped within 5-10 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody
20-abx305894
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Uhrf1bp1l sgRNA CRISPR Lentivector set (Rat)
K6609801 3 x 1.0 ug
EUR 406.8

UHRF1BP1L Protein Vector (Rat) (pPM-C-HA)
PV314460 500 ng
EUR 2985.6

UHRF1BP1L Polyclonal Antibody, HRP Conjugated
A61677
  • EUR 684.66
  • EUR 302.5
  • EUR 423.5
  • 100 µg
  • 50 ul
  • 100 ul

UHRF1BP1L Polyclonal Antibody, FITC Conjugated
A61676
  • EUR 684.66
  • EUR 302.5
  • EUR 423.5
  • 100 µg
  • 50 ul
  • 100 ul

UHRF1BP1L Protein Vector (Rat) (pPB-C-His)
PV314458 500 ng
EUR 2985.6

UHRF1BP1L Protein Vector (Rat) (pPB-N-His)
PV314459 500 ng
EUR 2985.6

UHRF1BP1L Protein Vector (Rat) (pPM-C-His)
PV314461 500 ng
EUR 2985.6

Uhrf1bp1l sgRNA CRISPR Lentivector set (Mouse)
K4538801 3 x 1.0 ug
EUR 406.8

UHRF1BP1L sgRNA CRISPR Lentivector set (Human)
K2586801 3 x 1.0 ug
EUR 406.8

UHRF1BP1L Protein Vector (Human) (pPM-C-HA)
PV045271 500 ng
EUR 394.8

UHRF1BP1L Protein Vector (Human) (pPM-C-HA)
PV059539 500 ng
EUR 577.2

UHRF1BP1L Protein Vector (Mouse) (pPM-C-HA)
PV244096 500 ng
EUR 2966.4

UHRF1BP1L Polyclonal Antibody, Biotin Conjugated
A61675
  • EUR 684.66
  • EUR 302.5
  • EUR 423.5
  • 100 µg
  • 50 ul
  • 100 ul

UHRF1BP1L Protein Vector (Human) (pPB-C-His)
PV045269 500 ng
EUR 394.8

UHRF1BP1L Protein Vector (Human) (pPB-N-His)
PV045270 500 ng
EUR 394.8

UHRF1BP1L Protein Vector (Human) (pPM-C-His)
PV045272 500 ng
EUR 394.8

UHRF1BP1L Protein Vector (Human) (pPB-C-His)
PV059537 500 ng
EUR 577.2

UHRF1BP1L Protein Vector (Human) (pPB-N-His)
PV059538 500 ng
EUR 577.2

UHRF1BP1L Protein Vector (Human) (pPM-C-His)
PV059540 500 ng
EUR 577.2

UHRF1BP1L Protein Vector (Mouse) (pPB-C-His)
PV244094 500 ng
EUR 2966.4

UHRF1BP1L Protein Vector (Mouse) (pPB-N-His)
PV244095 500 ng
EUR 2966.4

UHRF1BP1L Protein Vector (Mouse) (pPM-C-His)
PV244097 500 ng
EUR 2966.4

Uhrf1bp1l 3'UTR Luciferase Stable Cell Line
TU121570 1.0 ml Ask for price

UHRF1BP1L 3'UTR Luciferase Stable Cell Line
TU027815 1.0 ml
EUR 1672.8

Uhrf1bp1l 3'UTR Luciferase Stable Cell Line
TU222852 1.0 ml Ask for price

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody (HRP)
20-abx305895
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody (FITC)
20-abx305896
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody (Biotin)
20-abx305897
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human UHRF1-binding protein 1-like (UHRF1BP1L) ELISA Kit
abx384123-96tests 96 tests
EUR 1093.2
  • Shipped within 5-12 working days.

Uhrf1bp1l sgRNA CRISPR Lentivector (Rat) (Target 1)
K6609802 1.0 ug DNA
EUR 184.8

Uhrf1bp1l sgRNA CRISPR Lentivector (Rat) (Target 2)
K6609803 1.0 ug DNA
EUR 184.8

Uhrf1bp1l sgRNA CRISPR Lentivector (Rat) (Target 3)
K6609804 1.0 ug DNA
EUR 184.8

Mouse UHRF1- binding protein 1- like, Uhrf1bp1l ELISA KIT
ELI-36748m 96 Tests
EUR 1038

Human UHRF1- binding protein 1- like, UHRF1BP1L ELISA KIT
ELI-44737h 96 Tests
EUR 988.8

Uhrf1bp1l sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4538802 1.0 ug DNA
EUR 184.8

Uhrf1bp1l sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4538803 1.0 ug DNA
EUR 184.8

Uhrf1bp1l sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4538804 1.0 ug DNA
EUR 184.8

UHRF1BP1L sgRNA CRISPR Lentivector (Human) (Target 1)
K2586802 1.0 ug DNA
EUR 184.8

UHRF1BP1L sgRNA CRISPR Lentivector (Human) (Target 2)
K2586803 1.0 ug DNA
EUR 184.8

UHRF1BP1L sgRNA CRISPR Lentivector (Human) (Target 3)
K2586804 1.0 ug DNA
EUR 184.8

UHRF1BP1L Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV620737 1.0 ug DNA
EUR 2790

UHRF1BP1L Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV620741 1.0 ug DNA
EUR 2790

UHRF1BP1L Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV704649 1.0 ug DNA
EUR 540

UHRF1BP1L Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV704653 1.0 ug DNA
EUR 540

UHRF1BP1L Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV620742 1.0 ug DNA
EUR 2790

UHRF1BP1L Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV704654 1.0 ug DNA
EUR 540

Uhrf1bp1l sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6609805 3 x 1.0 ug
EUR 451.2

Uhrf1bp1l sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4538805 3 x 1.0 ug
EUR 451.2

UHRF1BP1L sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2586805 3 x 1.0 ug
EUR 451.2

Uhrf1bp1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6609806 1.0 ug DNA
EUR 200.4

Uhrf1bp1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6609807 1.0 ug DNA
EUR 200.4

Uhrf1bp1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6609808 1.0 ug DNA
EUR 200.4

Uhrf1bp1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4538806 1.0 ug DNA
EUR 200.4

Uhrf1bp1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4538807 1.0 ug DNA
EUR 200.4

Uhrf1bp1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4538808 1.0 ug DNA
EUR 200.4

UHRF1BP1L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2586806 1.0 ug DNA
EUR 200.4

UHRF1BP1L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2586807 1.0 ug DNA
EUR 200.4

UHRF1BP1L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2586808 1.0 ug DNA
EUR 200.4

 

CHARMM: the biomolecular simulation program.

CHARMM (Chemistry at HARvard Molecular Mechanics) is a extraordinarily versatile and broadly used molecular simulation program.

It has been developed over the previous three a few years with a primary give consideration to molecules of natural curiosity, along with proteins, peptides, lipids, nucleic acids, carbohydrates, and small molecule ligands, as they occur in reply, crystals, and membrane environments.

For the look at of such methods, this method offers a giant suite of computational devices that embrace fairly just a few conformational and path sampling methods, free vitality estimators, molecular minimization, dynamics, and analysis strategies, and model-building capabilities.

The CHARMM program is related to points involving a a lot wider class of many-particle methods.

Calculations with CHARMM could also be carried out using numerous fully totally different vitality options and fashions, from blended quantum mechanical-molecular mechanical stress fields, to all-atom classical potential vitality options with particular solvent and quite a few boundary circumstances, to implicit solvent and membrane fashions.

This method has been ported to fairly just a few platforms in every serial and parallel architectures. This textual content offers an overview of this method as a result of it exists within the current day with an emphasis on developments as a result of the publication of the distinctive CHARMM article in 1983.

 

Ghrelin is a growth-hormone-releasing acylated peptide from stomach.

 

Small synthetic molecules often known as growth-hormone secretagogues (GHSs) stimulate the discharge of improvement hormone (GH) from the pituitary. They act by means of GHS-R, a G-protein-coupled receptor for which the ligand is unknown.

Present cloning of GHS-R strongly implies that an endogenous ligand for the receptor does exist and that there is a mechanism for regulating GH launch that is distinct from its regulation by hypothalamic growth-hormone-releasing hormone (GHRH).

 

We now report the purification and identification in rat stomach of an endogenous ligand explicit for GHS-R.

The purified ligand is a peptide of 28 amino acids, by which the serine three residue is n-octanoylated. The acylated peptide notably releases GH every in vivo and in vitro, and O-n-octanoylation at serine three is essential for the train.

We designate the GH-releasing peptide ‘ghrelin’ (ghre is the Proto-Indo-European root of the phrase ‘develop’). Human ghrelin is homologous to rat ghrelin apart from two amino acids.

The incidence of ghrelin in every rat and human signifies that GH launch from the pituitary may be regulated not solely by hypothalamic GHRH, however as well as by ghrelin.

anti-Macrophage Inflammatory Protein 1 beta
YF-PA14543 100 ug
EUR 483.6
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 1 beta

anti-Macrophage inflammatory protein 5
YF-PA20144 50 ug
EUR 435.6
Description: Mouse polyclonal to Macrophage inflammatory protein 5

anti-Macrophage inflammatory protein 5
YF-PA20145 100 ul
EUR 483.6
Description: Rabbit polyclonal to Macrophage inflammatory protein 5

anti-Macrophage inflammatory protein 5
YF-PA20146 100 ug
EUR 483.6
Description: Rabbit polyclonal to Macrophage inflammatory protein 5

anti-Macrophage inflammatory protein 5
YF-PA14551 100 ul
EUR 483.6
Description: Rabbit polyclonal to Macrophage inflammatory protein 5

anti-Macrophage inflammatory protein 5
YF-PA14552 100 ug
EUR 483.6
Description: Rabbit polyclonal to Macrophage inflammatory protein 5

anti-Macrophage Inflammatory Protein 4
YF-PA14553 100 ul
EUR 483.6
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 4

anti-Macrophage Inflammatory Protein 4
YF-PA14554 100 ug
EUR 483.6
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 4

anti-Macrophage Inflammatory Protein 3
YF-PA14559 50 ug
EUR 435.6
Description: Mouse polyclonal to Macrophage Inflammatory Protein 3

anti-Macrophage Inflammatory Protein 3
YF-PA14560 100 ul
EUR 483.6
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 3

anti-Macrophage Inflammatory Protein 3
YF-PA14561 100 ug
EUR 483.6
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 3

anti-Macrophage inflammatory protein 5
YF-PA24672 50 ul
EUR 400.8
Description: Mouse polyclonal to Macrophage inflammatory protein 5

anti-Macrophage Inflammatory Protein 4
YF-PA24674 50 ul
EUR 400.8
Description: Mouse polyclonal to Macrophage Inflammatory Protein 4

Inflammatory profilin Antibody
20-abx110412
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Macrophage inflammatory protein 5 (1D7)
YF-MA15363 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage inflammatory protein 5

Anti-Macrophage inflammatory protein 5 (3H1)
YF-MA15365 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage inflammatory protein 5

Anti-Macrophage inflammatory protein 5 (3B7)
YF-MA15366 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage inflammatory protein 5

Anti-Macrophage inflammatory protein 5 (3B1)
YF-MA15367 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage inflammatory protein 5

Anti-Macrophage Inflammatory Protein 4 (2C6)
YF-MA15369 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage Inflammatory Protein 4

Anti-Macrophage inflammatory protein 5 (3D3)
YF-MA19031 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage inflammatory protein 5

Anti-Macrophage inflammatory protein 5 (4G10)
YF-MA15364 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage inflammatory protein 5

Anti-Macrophage Inflammatory Protein 1 beta?/CCL4 Antibody
PB9572 100ug/vial
EUR 352.8

Anti-Macrophage Inflammatory Protein 1 beta/CCL4 Antibody
PB9064 100ug/vial
EUR 352.8

Anti-Macrophage Inflammatory Protein 1 beta/CCL4 Antibody
PA1379 100ug/vial
EUR 352.8

Allograft Inflammatory Factor 1 Protein
20-abx262211
  • EUR 393.6
  • EUR 6991.2
  • EUR 276
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx109516
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx103213
  • EUR 393.6
  • EUR 159.6
  • EUR 1078.8
  • EUR 543.6
  • EUR 343.2
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx103214
  • EUR 360
  • EUR 844.8
  • EUR 427.2
  • EUR 184.8
  • EUR 292.8
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx103215
  • EUR 376.8
  • EUR 159.6
  • EUR 994.8
  • EUR 526.8
  • EUR 326.4
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx103216
  • EUR 543.6
  • EUR 159.6
  • EUR 1562.4
  • EUR 744
  • EUR 410.4
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx104925
  • EUR 560.4
  • EUR 159.6
  • EUR 1629.6
  • EUR 777.6
  • EUR 427.2
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx175326
  • EUR 393.6
  • EUR 159.6
  • EUR 1078.8
  • EUR 543.6
  • EUR 326.4
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx175327
  • EUR 1479.6
  • EUR 710.4
  • 1 mg
  • 200 ug
  • Please enquire.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx214166
  • EUR 493.2
  • EUR 360
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx214538
  • EUR 493.2
  • EUR 360
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx109254
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx110941
  • EUR 878.4
  • EUR 477.6
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
abx025719-400ul 400 ul
EUR 627.6
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
abx025719-80l 80 µl
EUR 343.2
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
abx037687-100ug 100 ug
EUR 469.2
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
abx037794-100ug 100 ug
EUR 469.2
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx131921
  • EUR 427.2
  • EUR 1095.6
  • EUR 560.4
  • EUR 184.8
  • EUR 326.4
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (Aif1) Antibody
20-abx319635
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx001285
  • EUR 493.2
  • EUR 710.4
  • EUR 218.4
  • EUR 376.8
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Inflammatory profilin Antibody (HRP)
20-abx108966
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-CCL3/Macrophage Inflammatory Protein 1 alpha Antibody
PB9571 100ug/vial
EUR 352.8

Anti-CCL3/Macrophage Inflammatory Protein 1 alpha Antibody
PB9022 100ug/vial
EUR 352.8

Inflammatory profilin Antibody (FITC)
20-abx107547
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat Allograft inflammatory factor 1 (Aif1)
1-CSB-YP001490RA
  • EUR 604.8
  • EUR 318
  • EUR 2198.4
  • EUR 915.6
  • EUR 1459.2
  • EUR 400.8
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 18.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Allograft inflammatory factor 1(Aif1) expressed in Yeast

Rat Allograft inflammatory factor 1 (Aif1)
1-CSB-EP001490RA
  • EUR 606
  • EUR 318
  • EUR 2192.4
  • EUR 919.2
  • EUR 1461.6
  • EUR 402
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 32.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Allograft inflammatory factor 1(Aif1) expressed in E.coli

Anti-Macrophage Inflammatory Protein 3 beta (3E9)
YF-MA15370 200 ul
EUR 435.6
Description: Mouse monoclonal to Macrophage Inflammatory Protein 3 beta

Inflammatory profilin Antibody (Biotin)
20-abx106133
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Allograft inflammatory factor 1 (AIF1)
1-CSB-EP001490HU
  • EUR 456
  • EUR 256.8
  • EUR 1570.8
  • EUR 672
  • EUR 1047.6
  • EUR 314.4
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 32.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Allograft inflammatory factor 1(AIF1),partial expressed in E.coli

Mouse Allograft inflammatory factor 1 (Aif1)
1-CSB-EP001490MO
  • EUR 606
  • EUR 318
  • EUR 2192.4
  • EUR 919.2
  • EUR 1461.6
  • EUR 402
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 20.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Allograft inflammatory factor 1(Aif1) expressed in E.coli

Allograft Inflammatory Factor 1 (AIF1) Antibody (HRP)
20-abx107953
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (HRP)
20-abx107954
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (Aif1) Antibody (HRP)
20-abx319636
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (FITC)
20-abx106536
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (FITC)
20-abx106537
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody Pair
20-abx370492
  • EUR 1528.8
  • EUR 994.8
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody Pair
20-abx370845
  • EUR 2114.4
  • EUR 1345.2
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-12 working days.

Allograft Inflammatory Factor 1 (Aif1) Antibody (FITC)
20-abx319637
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (FITC)
20-abx273634
  • EUR 427.2
  • EUR 276
  • EUR 1245.6
  • EUR 627.6
  • EUR 360
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (FITC)
20-abx274375
  • EUR 393.6
  • EUR 243.6
  • EUR 978
  • EUR 510
  • EUR 343.2
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Allograft Inflammatory Factor 1 Like Protein
20-abx260692
  • EUR 4101.6
  • EUR 393.6
  • EUR 276
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Human Macrophage Inflammatory Protein-1 beta
90218-A 2 µg
EUR 130
Description: Recombinant MIP-1 beta is a disulfide-linked homodimeric protein consisting of 70 amino acid residues, and migrates as an approximately 8 kDa protein under non-reducing and reducing conditions in SDS-PAGE. Optimized DNA sequence encoding Human MIP-1 beta chain was expressed in E. coli.

Human Macrophage Inflammatory Protein-1 beta
90218-B 10 µg
EUR 205
Description: Recombinant MIP-1 beta is a disulfide-linked homodimeric protein consisting of 70 amino acid residues, and migrates as an approximately 8 kDa protein under non-reducing and reducing conditions in SDS-PAGE. Optimized DNA sequence encoding Human MIP-1 beta chain was expressed in E. coli.

Anti-Macrophage Inflammatory Protein 4/CCL18 Antibody
PB9023 100ug/vial
EUR 352.8

Rat Allograft Inflammatory Factor 1 ELISA kit
E02A0627-192T 192 tests
EUR 1524
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Allograft Inflammatory Factor 1 ELISA kit
E02A0627-48 1 plate of 48 wells
EUR 624
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Allograft Inflammatory Factor 1 ELISA kit
E02A0627-96 1 plate of 96 wells
EUR 822
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Allograft Inflammatory Factor 1 ELISA kit
E07A0627-192T 192 tests
EUR 1524
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Allograft Inflammatory Factor 1 ELISA kit
E07A0627-48 1 plate of 48 wells
EUR 624
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Allograft Inflammatory Factor 1 ELISA kit
E07A0627-96 1 plate of 96 wells
EUR 822
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Allograft Inflammatory Factor 1 ELISA kit
E08A0627-192T 192 tests
EUR 1524
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Allograft Inflammatory Factor 1 ELISA kit
E08A0627-48 1 plate of 48 wells
EUR 624
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Allograft Inflammatory Factor 1 ELISA kit
E08A0627-96 1 plate of 96 wells
EUR 822
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin)
20-abx105119
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin)
20-abx105120
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (Aif1) Antibody (Biotin)
20-abx319638
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin)
20-abx272264
  • EUR 410.4
  • EUR 260.4
  • EUR 1161.6
  • EUR 594
  • EUR 343.2
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin)
20-abx272826
  • EUR 560.4
  • EUR 292.8
  • EUR 1612.8
  • EUR 760.8
  • EUR 410.4
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin)
20-abx273401
  • EUR 577.2
  • EUR 292.8
  • EUR 1696.8
  • EUR 794.4
  • EUR 427.2
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin)
20-abx274328
  • EUR 376.8
  • EUR 243.6
  • EUR 910.8
  • EUR 493.2
  • EUR 326.4
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin)
20-abx274640
  • EUR 477.6
  • EUR 260.4
  • EUR 1178.4
  • EUR 594
  • EUR 376.8
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Macrophage Inflammatory protein-1 alpha
90217-A 5 µg
EUR 130
Description: Recombinant MIP-1 alpha is a disulfide-linked homodimeric protein consisting of 70 amino acid residues, and migrates as an approximately 8 kDa protein under non-reducing and reducing conditions in SDS-PAGE. Optimized DNA sequence encoding Human MIP-1 alpha chain was expressed in E. coli.

Human Macrophage Inflammatory protein-1 alpha
90217-B 20 µg
EUR 205
Description: Recombinant MIP-1 alpha is a disulfide-linked homodimeric protein consisting of 70 amino acid residues, and migrates as an approximately 8 kDa protein under non-reducing and reducing conditions in SDS-PAGE. Optimized DNA sequence encoding Human MIP-1 alpha chain was expressed in E. coli.

Goat Allograft Inflammatory Factor 1 ELISA kit
E06A0627-192T 192 tests
EUR 1524
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Allograft Inflammatory Factor 1 ELISA kit
E06A0627-48 1 plate of 48 wells
EUR 624
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Allograft Inflammatory Factor 1 ELISA kit
E06A0627-96 1 plate of 96 wells
EUR 822
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Macrophage Inflammatory Protein 1 Beta (MIP1b) Antibody
20-abx313218
  • EUR 493.2
  • EUR 2214
  • EUR 718.8
  • EUR 218.4
  • EUR 360
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Macrophage Inflammatory Protein 1 Beta (MIP1b) Antibody
20-abx104064
  • EUR 376.8
  • EUR 159.6
  • EUR 978
  • EUR 510
  • EUR 326.4
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Macrophage Inflammatory Protein 1 Beta (MIP1b) Antibody
20-abx104065
  • EUR 510
  • EUR 159.6
  • EUR 1412.4
  • EUR 693.6
  • EUR 393.6
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Macrophage Inflammatory Protein 1 Beta (MIP1b) Antibody
20-abx104066
  • EUR 526.8
  • EUR 159.6
  • EUR 1479.6
  • EUR 710.4
  • EUR 393.6
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

 

Tim

Leave A Comment

December 2023
M T W T F S S
 123
45678910
11121314151617
18192021222324
25262728293031