Posted in Antibodies, Assay Kits, Biology Cells, cDNA, Clia Kits, Culture Cells, Devices, DNA, DNA Templates, DNA Testing, Elisa Kits, Enzymes, Equipments, Exosomes, Gels, Isotypes, Medium & Serums, NATtrol, Panel, Particles, PCR, Pcr Kits, Peptides, Reagents, Recombinant Proteins, Ria Kits, RNA, Test Kits, Vector & Virus, Western Blot
An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database.
An technique to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database.
A method to correlate the uninterpreted tandem mass spectra of peptides produced beneath low vitality (10-50 eV) collision circumstances with amino acid sequences throughout the Genpept database has been developed. On this system the protein database is searched to find out linear amino acid sequences inside a mass tolerance of ±1 u of the precursor ion molecular weight A cross-correlation function is then used to produce a measurement of similarity between the mass-to-charge ratios for the fragment ions predicted from amino acid sequences obtained from the database and the fragment ions seen throughout the tandem mass spectrum.
Usually, a distinction larger than 0.1 between the normalized cross-correlation options of the first- and second-ranked search outcomes signifies a worthwhile match between sequence and spectrum. Searches of species-specific protein databases with tandem mass spectra acquired from peptides obtained from the enzymatically digested complete proteins of E. coli and S.
cerevisiae cells allowed matching of the spectra to amino acid sequences inside proteins of these organisms. The technique described on this manuscript offers a useful methodology to interpret tandem mass spectra with acknowledged sequences in a protein database.
UHRF1BP1L siRNA |
20-abx938994 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UHRF1BP1L Antibody |
1-CSB-PA025606LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
UHRF1BP1L Antibody |
6461-002mg |
ProSci |
0.02 mg |
EUR 206.18 |
- Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
|
Description: UHRF1BP1L Antibody: The Ubiquitin-like containing PHD and RING finger domains 1-binding protein 1-like (UHRF1BP1L) is closely related to UHRF1BP1, also known as ICBP90, a transcription and cell cycle regulator that specifically binds to the histone H3 N-terminal tail. While little is known of UHRF1BP1L, UHRF1BP1 is required for proper heterochromatin formation in mammalian cells. Furthermore, UHRF1BP1 is thought to be a pivotal target for the ERK1/2 signaling pathway to control the proliferation of Jurkat T cells, suggesting that UHRF1BP1L may also be involved in chromatin regulation and cell proliferation. |
UHRF1BP1L Antibody |
6461-01mg |
ProSci |
0.1 mg |
EUR 523.7 |
- Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
|
Description: UHRF1BP1L Antibody: The Ubiquitin-like containing PHD and RING finger domains 1-binding protein 1-like (UHRF1BP1L) is closely related to UHRF1BP1, also known as ICBP90, a transcription and cell cycle regulator that specifically binds to the histone H3 N-terminal tail. While little is known of UHRF1BP1L, UHRF1BP1 is required for proper heterochromatin formation in mammalian cells. Furthermore, UHRF1BP1 is thought to be a pivotal target for the ERK1/2 signaling pathway to control the proliferation of Jurkat T cells, suggesting that UHRF1BP1L may also be involved in chromatin regulation and cell proliferation. |
UHRF1BP1L Antibody |
25349-100ul |
SAB |
100ul |
EUR 468 |
UHRF1BP1L cloning plasmid |
CSB-CL025606HU1-10ug |
Cusabio |
10ug |
EUR 451.2 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1569
- Sequence: atggccgggatcatcaagaaacaaatcttgaagcacctctccagatttaccaaaaatttatctcctgacaagataaatctaagtacccttaaaggagaaggtgaactgaagaatttggagttggatgaagaagtactccagaatatgttggatttgccaacatggcttgctatca
- Show more
|
Description: A cloning plasmid for the UHRF1BP1L gene. |
UHRF1BP1L cloning plasmid |
CSB-CL025606HU2-10ug |
Cusabio |
10ug |
EUR 1308 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3033
- Sequence: ATGGCCGGGATCATCAAGAAACAAATCTTGAAGCACCTCTCCAGATTTACCAAAAATTTATCTCCTGACAAGATAAATCTAAGTACCCTTAAAGGAGAAGGTGAACTGAAGAATTTGGAGTTGGATGAAGAAGTACTCCAGAATATGTTGGATTTGCCAACATGGCTTGCTATCA
- Show more
|
Description: A cloning plasmid for the UHRF1BP1L gene. |
Polyclonal UHRF1BP1L Antibody |
APR06720G |
Leading Biology |
0.1 mg |
EUR 790.8 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UHRF1BP1L . This antibody is tested and proven to work in the following applications: |
anti- UHRF1BP1L antibody |
FNab09246 |
FN Test |
100µg |
EUR 702 |
- Recommended dilution: WB: 1:500-1:5000
- IP: 1:500-1:5000
- Immunogen: UHRF1 binding protein 1-like
- Uniprot ID: A0JNW5
- Gene ID: 23074
|
Description: Antibody raised against UHRF1BP1L |
UHRF1BP1L Polyclonal Antibody |
A61674-020 |
EpiGentek |
20 ul |
EUR 117.7 |
UHRF1BP1L Polyclonal Antibody |
A61674-050 |
EpiGentek |
50 ul |
EUR 302.5 |
UHRF1BP1L Polyclonal Antibody |
A61674-100 |
EpiGentek |
100 ul |
EUR 423.5 |
UHRF1BP1L Polyclonal Antibody |
A61674 |
EpiGentek |
-
EUR 684.66
-
EUR 117.70
-
EUR 302.50
-
EUR 423.50
|
-
100 µg
-
20 ul
-
50 ul
-
100 ul
|
Mouse UHRF1BP1L shRNA Plasmid |
20-abx978348 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human UHRF1BP1L shRNA Plasmid |
20-abx957978 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
UHRF1BP1L Antibody, HRP conjugated |
1-CSB-PA025606LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
UHRF1BP1L Antibody, FITC conjugated |
1-CSB-PA025606LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
UHRF1BP1L Antibody, Biotin conjugated |
1-CSB-PA025606LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Uhrf1bp1l ORF Vector (Rat) (pORF) |
ORF078615 |
ABM |
1.0 ug DNA |
EUR 2496 |
Uhrf1bp1l ORF Vector (Mouse) (pORF) |
ORF061024 |
ABM |
1.0 ug DNA |
EUR 1886.4 |
UHRF1BP1L ORF Vector (Human) (pORF) |
ORF014885 |
ABM |
1.0 ug DNA |
EUR 424.8 |
UHRF1BP1L ORF Vector (Human) (pORF) |
ORF011318 |
ABM |
1.0 ug DNA |
EUR 114 |
UHRF1BP1L Polyclonal Antibody, Biotin Conjugated |
A61675-050 |
EpiGentek |
50 ul |
EUR 302.5 |
UHRF1BP1L Polyclonal Antibody, Biotin Conjugated |
A61675-100 |
EpiGentek |
100 ul |
EUR 423.5 |
UHRF1BP1L Polyclonal Antibody, FITC Conjugated |
A61676-050 |
EpiGentek |
50 ul |
EUR 302.5 |
UHRF1BP1L Polyclonal Antibody, FITC Conjugated |
A61676-100 |
EpiGentek |
100 ul |
EUR 423.5 |
UHRF1BP1L Polyclonal Antibody, HRP Conjugated |
A61677-050 |
EpiGentek |
50 ul |
EUR 302.5 |
UHRF1BP1L Polyclonal Antibody, HRP Conjugated |
A61677-100 |
EpiGentek |
100 ul |
EUR 423.5 |
UHRF1BP1L Polyclonal Antibody, Biotin Conjugated |
A61675 |
EpiGentek |
-
EUR 684.66
-
EUR 302.50
-
EUR 423.50
|
|
UHRF1BP1L Polyclonal Antibody, FITC Conjugated |
A61676 |
EpiGentek |
-
EUR 684.66
-
EUR 302.50
-
EUR 423.50
|
|
UHRF1BP1L Polyclonal Antibody, HRP Conjugated |
A61677 |
EpiGentek |
-
EUR 684.66
-
EUR 302.50
-
EUR 423.50
|
|
Canine C-Peptide ELISA Kit |
DLR-C-Peptide-c-48T |
DL Develop |
48T |
EUR 632.4 |
- Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Canine C-Peptide ELISA Kit |
DLR-C-Peptide-c-96T |
DL Develop |
96T |
EUR 825.6 |
- Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human C-Peptide ELISA Kit |
DLR-C-Peptide-Hu-48T |
DL Develop |
48T |
EUR 477.6 |
- Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human C-Peptide ELISA Kit |
DLR-C-Peptide-Hu-96T |
DL Develop |
96T |
EUR 613.2 |
- Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse C-Peptide ELISA Kit |
DLR-C-Peptide-Mu-48T |
DL Develop |
48T |
EUR 540 |
- Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse C-Peptide ELISA Kit |
DLR-C-Peptide-Mu-96T |
DL Develop |
96T |
EUR 698.4 |
- Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat C-Peptide ELISA Kit |
DLR-C-Peptide-Ra-48T |
DL Develop |
48T |
EUR 560.4 |
- Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat C-Peptide ELISA Kit |
DLR-C-Peptide-Ra-96T |
DL Develop |
96T |
EUR 726 |
- Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Canine C-Peptide ELISA Kit |
RDR-C-Peptide-c-48Tests |
Reddot Biotech |
48 Tests |
EUR 668.4 |
Canine C-Peptide ELISA Kit |
RDR-C-Peptide-c-96Tests |
Reddot Biotech |
96 Tests |
EUR 928.8 |
Human C-Peptide ELISA Kit |
RDR-C-Peptide-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 484.8 |
Human C-Peptide ELISA Kit |
RDR-C-Peptide-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 667.2 |
Mouse C-Peptide ELISA Kit |
RDR-C-Peptide-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 558 |
Mouse C-Peptide ELISA Kit |
RDR-C-Peptide-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 771.6 |
Rat C-Peptide ELISA Kit |
RDR-C-Peptide-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583.2 |
Rat C-Peptide ELISA Kit |
RDR-C-Peptide-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 806.4 |
Canine C-Peptide ELISA Kit |
RD-C-Peptide-c-48Tests |
Reddot Biotech |
48 Tests |
EUR 639.6 |
Canine C-Peptide ELISA Kit |
RD-C-Peptide-c-96Tests |
Reddot Biotech |
96 Tests |
EUR 888 |
Human C-Peptide ELISA Kit |
RD-C-Peptide-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 464.4 |
Human C-Peptide ELISA Kit |
RD-C-Peptide-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 638.4 |
Mouse C-Peptide ELISA Kit |
RD-C-Peptide-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 535.2 |
Mouse C-Peptide ELISA Kit |
RD-C-Peptide-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 738 |
Rat C-Peptide ELISA Kit |
RD-C-Peptide-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 558 |
Rat C-Peptide ELISA Kit |
RD-C-Peptide-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 771.6 |
UHRF1BP1L sgRNA CRISPR Lentivector set (Human) |
K2586801 |
ABM |
3 x 1.0 ug |
EUR 406.8 |
Uhrf1bp1l sgRNA CRISPR Lentivector set (Mouse) |
K4538801 |
ABM |
3 x 1.0 ug |
EUR 406.8 |
Uhrf1bp1l sgRNA CRISPR Lentivector set (Rat) |
K6609801 |
ABM |
3 x 1.0 ug |
EUR 406.8 |
UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody |
abx028888-400ul |
Abbexa |
400 ul |
EUR 627.6 |
- Shipped within 5-10 working days.
|
UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody |
abx028888-80l |
Abbexa |
80 µl |
EUR 343.2 |
- Shipped within 5-10 working days.
|
UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody |
20-abx305894 |
Abbexa |
-
EUR 493.20
-
EUR 2214.00
-
EUR 718.80
-
EUR 218.40
-
EUR 360.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody |
abx239246-100ug |
Abbexa |
100 ug |
EUR 661.2 |
- Shipped within 5-12 working days.
|
UHRF1BP1L sgRNA CRISPR Lentivector (Human) (Target 1) |
K2586802 |
ABM |
1.0 ug DNA |
EUR 184.8 |
UHRF1BP1L sgRNA CRISPR Lentivector (Human) (Target 2) |
K2586803 |
ABM |
1.0 ug DNA |
EUR 184.8 |
UHRF1BP1L sgRNA CRISPR Lentivector (Human) (Target 3) |
K2586804 |
ABM |
1.0 ug DNA |
EUR 184.8 |
Uhrf1bp1l sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4538802 |
ABM |
1.0 ug DNA |
EUR 184.8 |
Uhrf1bp1l sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4538803 |
ABM |
1.0 ug DNA |
EUR 184.8 |
Uhrf1bp1l sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4538804 |
ABM |
1.0 ug DNA |
EUR 184.8 |
Uhrf1bp1l sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6609802 |
ABM |
1.0 ug DNA |
EUR 184.8 |
Uhrf1bp1l sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6609803 |
ABM |
1.0 ug DNA |
EUR 184.8 |
Uhrf1bp1l sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6609804 |
ABM |
1.0 ug DNA |
EUR 184.8 |
UHRF1BP1L Protein Vector (Human) (pPB-C-His) |
PV045269 |
ABM |
500 ng |
EUR 394.8 |
UHRF1BP1L Protein Vector (Human) (pPB-N-His) |
PV045270 |
ABM |
500 ng |
EUR 394.8 |
UHRF1BP1L Protein Vector (Human) (pPM-C-HA) |
PV045271 |
ABM |
500 ng |
EUR 394.8 |
UHRF1BP1L Protein Vector (Human) (pPM-C-His) |
PV045272 |
ABM |
500 ng |
EUR 394.8 |
UHRF1BP1L Protein Vector (Human) (pPB-C-His) |
PV059537 |
ABM |
500 ng |
EUR 577.2 |
UHRF1BP1L Protein Vector (Human) (pPB-N-His) |
PV059538 |
ABM |
500 ng |
EUR 577.2 |
UHRF1BP1L Protein Vector (Human) (pPM-C-HA) |
PV059539 |
ABM |
500 ng |
EUR 577.2 |
UHRF1BP1L Protein Vector (Human) (pPM-C-His) |
PV059540 |
ABM |
500 ng |
EUR 577.2 |
UHRF1BP1L Protein Vector (Mouse) (pPB-C-His) |
PV244094 |
ABM |
500 ng |
EUR 2966.4 |
UHRF1BP1L Protein Vector (Mouse) (pPB-N-His) |
PV244095 |
ABM |
500 ng |
EUR 2966.4 |
UHRF1BP1L Protein Vector (Mouse) (pPM-C-HA) |
PV244096 |
ABM |
500 ng |
EUR 2966.4 |
UHRF1BP1L Protein Vector (Mouse) (pPM-C-His) |
PV244097 |
ABM |
500 ng |
EUR 2966.4 |
UHRF1BP1L Protein Vector (Rat) (pPB-C-His) |
PV314458 |
ABM |
500 ng |
EUR 2985.6 |
UHRF1BP1L Protein Vector (Rat) (pPB-N-His) |
PV314459 |
ABM |
500 ng |
EUR 2985.6 |
CHARMM: the biomolecular simulation program.
CHARMM (Chemistry at HARvard Molecular Mechanics) is a extraordinarily versatile and broadly used molecular simulation program.
It has been developed over the previous three a few years with a primary give consideration to molecules of natural curiosity, along with proteins, peptides, lipids, nucleic acids, carbohydrates, and small molecule ligands, as they occur in reply, crystals, and membrane environments.
For the look at of such methods, this method offers a giant suite of computational devices that embrace fairly just a few conformational and path sampling methods, free vitality estimators, molecular minimization, dynamics, and analysis strategies, and model-building capabilities.
The CHARMM program is related to points involving a a lot wider class of many-particle methods.
Calculations with CHARMM could also be carried out using numerous fully totally different vitality options and fashions, from blended quantum mechanical-molecular mechanical stress fields, to all-atom classical potential vitality options with particular solvent and quite a few boundary circumstances, to implicit solvent and membrane fashions.
This method has been ported to fairly just a few platforms in every serial and parallel architectures. This textual content offers an overview of this method as a result of it exists within the current day with an emphasis on developments as a result of the publication of the distinctive CHARMM article in 1983.
Ghrelin is a growth-hormone-releasing acylated peptide from stomach.
Small synthetic molecules often known as growth-hormone secretagogues (GHSs) stimulate the discharge of improvement hormone (GH) from the pituitary. They act by means of GHS-R, a G-protein-coupled receptor for which the ligand is unknown.
Present cloning of GHS-R strongly implies that an endogenous ligand for the receptor does exist and that there is a mechanism for regulating GH launch that is distinct from its regulation by hypothalamic growth-hormone-releasing hormone (GHRH).
We now report the purification and identification in rat stomach of an endogenous ligand explicit for GHS-R.
The purified ligand is a peptide of 28 amino acids, by which the serine three residue is n-octanoylated. The acylated peptide notably releases GH every in vivo and in vitro, and O-n-octanoylation at serine three is essential for the train.
We designate the GH-releasing peptide ‘ghrelin’ (ghre is the Proto-Indo-European root of the phrase ‘develop’). Human ghrelin is homologous to rat ghrelin apart from two amino acids.
The incidence of ghrelin in every rat and human signifies that GH launch from the pituitary may be regulated not solely by hypothalamic GHRH, however as well as by ghrelin.
Goat Anti-Mouse IgG Fc, 10MG |
A008-10MG |
Arbor Assays |
10MG |
EUR 321.6 |
Goat Anti-Rabbit IgG Fc, 10MG |
A009-10MG |
Arbor Assays |
10MG |
EUR 321.6 |
Anti-Inflammatory Peptide 1 |
5-00709 |
CHI Scientific |
4 x 5mg |
Ask for price |
Anti-Inflammatory Peptide 1 |
A1008-10 |
ApexBio |
10 mg |
EUR 199.2 |
Description: Anti-Inflammatory Peptide 1 (C45H82N12O14S2), with the sequence H-Met-Gln-Met-Lys-Lys-Val-Leu-Asp-Ser-OH, belongs to the group of synthetic oligopeptides corresponding to a region of high amino-acid sequence similarity between uteroglobin and lipocortin I |
Anti-Inflammatory Peptide 1 |
A1008-25 |
ApexBio |
25 mg |
EUR 254.4 |
Description: Anti-Inflammatory Peptide 1 (C45H82N12O14S2), with the sequence H-Met-Gln-Met-Lys-Lys-Val-Leu-Asp-Ser-OH, belongs to the group of synthetic oligopeptides corresponding to a region of high amino-acid sequence similarity between uteroglobin and lipocortin I |
Anti-Inflammatory Peptide 1 |
A1008-5 |
ApexBio |
5 mg |
EUR 142.8 |
Description: Anti-Inflammatory Peptide 1 (C45H82N12O14S2), with the sequence H-Met-Gln-Met-Lys-Lys-Val-Leu-Asp-Ser-OH, belongs to the group of synthetic oligopeptides corresponding to a region of high amino-acid sequence similarity between uteroglobin and lipocortin I |
Anti-Inflammatory Peptide 1 |
H-9435.0005 |
Bachem |
5.0mg |
EUR 327.6 |
Description: Sum Formula: C45H82N12O14S2; CAS# [118850-71-8] |
Anti-Inflammatory Peptide 1 |
H-9435.0025 |
Bachem |
25.0mg |
EUR 1197.6 |
Description: Sum Formula: C45H82N12O14S2; CAS# [118850-71-8] |
Doxorubicin HCl, 10mg |
R2531-10mg |
ACTGene |
each |
EUR 236.4 |
Donkey Anti-Sheep IgG (H&L), 10MG |
A010-10MG |
Arbor Assays |
10MG |
EUR 321.6 |
Recombinant other protein 1, Untagged, E.coli-10mg |
QP13162-10mg |
EnQuireBio |
10mg |
EUR 241.2 |
Recombinant other Alarelin Protein, Untagged, -10mg |
QP10997-10mg |
EnQuireBio |
10mg |
EUR 241.2 |
Anti-Inflammatory Peptide 2 |
5-00710 |
CHI Scientific |
4 x 5mg |
Ask for price |
Anti-Inflammatory Peptide 3 |
5-00711 |
CHI Scientific |
4 x 5mg |
Ask for price |
Anti-Inflammatory Peptide 2 |
H-9440.0005 |
Bachem |
5.0mg |
EUR 327.6 |
Description: Sum Formula: C46H77N13O15S; CAS# [118850-72-9] |
Anti-Inflammatory Peptide 2 |
H-9440.0025 |
Bachem |
25.0mg |
EUR 1197.6 |
Description: Sum Formula: C46H77N13O15S; CAS# [118850-72-9] |
Recombinant other protein 1, Untagged, E.coli-10mg |
QP10853-EC-10mg |
EnQuireBio |
10mg |
EUR 186 |
Recombinant Human GH1/ Growth hormone 1 Protein, Untagged, E.coli-10mg |
QP5354-10mg |
EnQuireBio |
10mg |
EUR 1491.6 |
Recombinant other Avidin Biotin Protein, Untagged, -10mg |
QP10526-10mg |
EnQuireBio |
10mg |
EUR 241.2 |
Recombinant Human CTRB1 Protein, Untagged, E.coli-10mg |
QP10565-10mg |
EnQuireBio |
10mg |
EUR 241.2 |
Recombinant Human Insulin Protein, Untagged, E.coli-10mg |
QP10732-10mg |
EnQuireBio |
10mg |
EUR 241.2 |
Recombinant other Lysostaphin Protein, Untagged, E.coli-10mg |
QP10778-10mg |
EnQuireBio |
10mg |
EUR 501.6 |
Recombinant Multi Species ACTH Protein, Untagged, -10mg |
QP10950-10mg |
EnQuireBio |
10mg |
EUR 241.2 |
Recombinant other Atosiban Protein, Untagged, E.coli-10mg |
QP11102-10mg |
EnQuireBio |
10mg |
EUR 186 |
Recombinant E.coli LACTB Protein, Untagged, E.coli-10mg |
QP12522-10mg |
EnQuireBio |
10mg |
EUR 1154.4 |
Recombinant other Lanreotide Protein, Untagged, E.coli-10mg |
QP12536-10mg |
EnQuireBio |
10mg |
EUR 675.6 |
Recombinant Human LHRH Protein, Untagged, E.coli-10mg |
QP12569-10mg |
EnQuireBio |
10mg |
EUR 186 |
Recombinant other SPA Protein, His, E.coli-10mg |
QP13566-10mg |
EnQuireBio |
10mg |
EUR 186 |
Recombinant other SST Protein, Untagged, E.coli-10mg |
QP13598-10mg |
EnQuireBio |
10mg |
EUR 241.2 |
Recombinant Rabbit TNC Protein, Untagged, Rabbit-10mg |
QP13765-10mg |
EnQuireBio |
10mg |
EUR 1273.2 |
Recombinant other Cetrorelix Protein, Untagged, E.coli-10mg |
QP11394-10mg |
EnQuireBio |
10mg |
EUR 1034.4 |
Recombinant Human EDN3 Protein, Untagged, E.coli-10mg |
QP11747-10mg |
EnQuireBio |
10mg |
EUR 2818.8 |
Recombinant other Exenatide Protein, Untagged, E.coli-10mg |
QP11816-10mg |
EnQuireBio |
10mg |
EUR 1154.4 |
Recombinant Human Leptin Protein, Untagged, E.coli-10mg |
QP5350-10mg |
EnQuireBio |
10mg |
EUR 610.8 |
Recombinant Mouse Leptin Protein, Untagged, E.coli-10mg |
QP5429-10mg |
EnQuireBio |
10mg |
EUR 1154.4 |
Recombinant Rat Leptin Protein, Untagged, E.coli-10mg |
QP5507-10mg |
EnQuireBio |
10mg |
EUR 1099.2 |
Polyclonal Goat anti-GST α-form |
GST-ANTI-1 |
Detroit R&D |
50 uL |
EUR 336 |
Recombinant other hCG Protein, Untagged, Native Protein-10mg |
QP10664-10mg |
EnQuireBio |
10mg |
EUR 294 |
Recombinant other Lipase A Protein, Untagged, E.coli-10mg |
QP10772-10mg |
EnQuireBio |
10mg |
EUR 186 |
Recombinant Human MG Protein, Untagged, Native Protein-10mg |
QP10785-10mg |
EnQuireBio |
10mg |
EUR 588 |
Recombinant Bovine Trypsin Protein, Untagged, Native Protein-10mg |
QP10896-10mg |
EnQuireBio |
10mg |
EUR 241.2 |
Recombinant Human UTI Protein, Untagged, Native Protein-10mg |
QP10909-10mg |
EnQuireBio |
10mg |
EUR 250.8 |
Recombinant Human A2M Protein, Untagged, Native Protein-10mg |
QP10922-10mg |
EnQuireBio |
10mg |
EUR 1948.8 |
Recombinant Human APOB Protein, Untagged, Native Protein-10mg |
QP11047-10mg |
EnQuireBio |
10mg |
EUR 5463.6 |
Recombinant Human B2M Protein, Untagged, Native Protein-10mg |
QP11117-10mg |
EnQuireBio |
10mg |
EUR 1698 |
Recombinant Human LDL Protein, Untagged, Native Protein-10mg |
QP12550-10mg |
EnQuireBio |
10mg |
EUR 195.6 |
Recombinant Human LTF Protein, Untagged, Native Protein-10mg |
QP12595-10mg |
EnQuireBio |
10mg |
EUR 5821.2 |
Recombinant Human LTF Holo Protein, Untagged, Rice-10mg |
QP12596-10mg |
EnQuireBio |
10mg |
EUR 186 |
Recombinant Human Myoglobin Protein, Untagged, Native Protein-10mg |
QP12776-10mg |
EnQuireBio |
10mg |
EUR 2470.8 |
Recombinant other Protein-L Protein, Untagged, E.coli-10mg |
QP13168-10mg |
EnQuireBio |
10mg |
EUR 241.2 |
Recombinant other SPA 33.4kDa Protein, Untagged, E.coli-10mg |
QP13567-10mg |
EnQuireBio |
10mg |
EUR 186 |
Recombinant other SPA Long Protein, Untagged, E.coli-10mg |
QP13568-10mg |
EnQuireBio |
10mg |
EUR 186 |
Recombinant other SPA-Cys Protein, Untagged, E.coli-10mg |
QP13569-10mg |
EnQuireBio |
10mg |
EUR 186 |
Recombinant other Streptavidin Protein, Untagged, Native Protein-10mg |
QP13625-10mg |
EnQuireBio |
10mg |
EUR 241.2 |
Recombinant Multi Species Trp Protein, Untagged, E.coli-10mg |
QP13821-10mg |
EnQuireBio |
10mg |
EUR 294 |
Recombinant Human C1q Protein, Untagged, Native Protein-10mg |
QP11228-10mg |
EnQuireBio |
10mg |
EUR 5463.6 |
Recombinant Human C3c Protein, Untagged, Native Protein-10mg |
QP11238-10mg |
EnQuireBio |
10mg |
EUR 1393.2 |
Recombinant Human C4c Protein, Untagged, Native Protein-10mg |
QP11240-10mg |
EnQuireBio |
10mg |
EUR 4267.2 |
Recombinant Human CKM Protein, Untagged, Native Protein-10mg |
QP11436-10mg |
EnQuireBio |
10mg |
EUR 5767.2 |
Recombinant Human CRP Protein, Untagged, Native Protein-10mg |
QP11511-10mg |
EnQuireBio |
10mg |
EUR 1099.2 |
Recombinant Human Ferritin Protein, Untagged, Native Protein-10mg |
QP11867-10mg |
EnQuireBio |
10mg |
EUR 2589.6 |
Recombinant Bovine Fibronectin Protein, Untagged, Native Protein-10mg |
QP11880-10mg |
EnQuireBio |
10mg |
EUR 1220.4 |
Recombinant Human Fibronectin Protein, Untagged, Native Protein-10mg |
QP11881-10mg |
EnQuireBio |
10mg |
EUR 1220.4 |
Recombinant Human Haptoglobin Protein, Untagged, Native Protein-10mg |
QP12103-10mg |
EnQuireBio |
10mg |
EUR 2350.8 |
Recombinant Human HbA1c Protein, Untagged, Native Protein-10mg |
QP12117-10mg |
EnQuireBio |
10mg |
EUR 2710.8 |
Recombinant Human HDL Protein, Untagged, Native Protein-10mg |
QP12211-10mg |
EnQuireBio |
10mg |
EUR 241.2 |
Recombinant other HSA Protein, Untagged, Pichia Pastoris-10mg |
QP12314-10mg |
EnQuireBio |
10mg |
EUR 186 |
Recombinant other HSA Recombinant Protein, Untagged, Rice-10mg |
QP12317-10mg |
EnQuireBio |
10mg |
EUR 195.6 |
Recombinant other Protein-A/G Protein, His, E.coli-10mg |
QP13163-10mg |
EnQuireBio |
10mg |
EUR 241.2 |
Recombinant other Protein-G His Protein, His, E.coli-10mg |
QP13167-10mg |
EnQuireBio |
10mg |
EUR 381.6 |
Recombinant other Protein-L Cys Protein, Untagged, E.coli-10mg |
QP13169-10mg |
EnQuireBio |
10mg |
EUR 241.2 |
Recombinant other SPA-Cys His Protein, His, E.coli-10mg |
QP13570-10mg |
EnQuireBio |
10mg |
EUR 186 |
Recombinant other SPA-Cys Long Protein, Untagged, E.coli-10mg |
QP13571-10mg |
EnQuireBio |
10mg |
EUR 186 |
Recombinant Human Collagen-III Protein, Untagged, Pichia Pastoris-10mg |
QP11479-10mg |
EnQuireBio |
10mg |
EUR 337.2 |
Recombinant other Cys-Protein-G Protein, Untagged, E.coli-10mg |
QP11587-10mg |
EnQuireBio |
10mg |
EUR 381.6 |
Recombinant other Cys-Protein-L Protein, Untagged, E.coli-10mg |
QP11588-10mg |
EnQuireBio |
10mg |
EUR 241.2 |
Recombinant other HSA Lipid free Protein, Untagged, Rice-10mg |
QP12316-10mg |
EnQuireBio |
10mg |
EUR 195.6 |
Anti-Kentsin Peptide |
20-abx265748 |
Abbexa |
-
EUR 393.60
-
EUR 594.00
-
EUR 326.40
|
|
- Shipped within 5-10 working days.
|
Anti-Flt1 Peptide |
20-abx265801 |
Abbexa |
-
EUR 393.60
-
EUR 594.00
-
EUR 326.40
|
|
- Shipped within 5-10 working days.
|
Recombinant other Protein Cys-A/G Protein, Untagged, E.coli-10mg |
QP13161-10mg |
EnQuireBio |
10mg |
EUR 241.2 |
Recombinant other Protein-A/G Cys Protein, Untagged, E.coli-10mg |
QP13164-10mg |
EnQuireBio |
10mg |
EUR 241.2 |
Recombinant other Protein-A/G/L Protein, Untagged, E.coli-10mg |
QP13165-10mg |
EnQuireBio |
10mg |
EUR 392.4 |
Rabbit Polyclonal antibody Anti-CRBN |
Anti-CRBN |
ImmunoStep |
50 µg |
EUR 418.8 |
Recombinant other Protein-A/G/L-Cys Protein, Untagged, E.coli-10mg |
QP13166-10mg |
EnQuireBio |
10mg |
EUR 392.4 |
Recombinant other Cys-Protein-A/G/L Protein, Untagged, E.coli-10mg |
QP11586-10mg |
EnQuireBio |
10mg |
EUR 392.4 |
Hemokinin 1 Peptide |
20-abx265072 |
Abbexa |
-
EUR 594.00
-
EUR 978.00
-
EUR 427.20
|
|
- Shipped within 5-10 working days.
|
Hemokinin 1 Peptide |
20-abx265383 |
Abbexa |
-
EUR 594.00
-
EUR 978.00
-
EUR 427.20
|
|
- Shipped within 5-10 working days.
|
Achatin-1 Peptide |
20-abx265822 |
Abbexa |
-
EUR 410.40
-
EUR 627.60
-
EUR 326.40
|
|
- Shipped within 5-10 working days.
|
Endomorphin-1 Peptide |
20-abx265857 |
Abbexa |
-
EUR 427.20
-
EUR 644.40
-
EUR 343.20
|
|
- Shipped within 5-10 working days.
|
AF-1 Peptide |
20-abx265891 |
Abbexa |
-
EUR 427.20
-
EUR 644.40
-
EUR 343.20
|
|
- Shipped within 5-10 working days.
|
WWamide-1 Peptide |
20-abx265990 |
Abbexa |
-
EUR 460.80
-
EUR 710.40
-
EUR 360.00
|
|
- Shipped within 5-10 working days.
|
S6-1 Peptide |
20-abx266162 |
Abbexa |
-
EUR 526.80
-
EUR 861.60
-
EUR 393.60
|
|
- Shipped within 5-10 working days.
|
KL-1 Peptide |
20-abx266293 |
Abbexa |
-
EUR 594.00
-
EUR 978.00
-
EUR 427.20
|
|
- Shipped within 5-10 working days.
|
Alloferon 1 Peptide |
20-abx266358 |
Abbexa |
-
EUR 627.60
-
EUR 1045.20
-
EUR 460.80
|
|
- Shipped within 5-10 working days.
|