Posted in Antibodies, Assay Kits, Biology Cells, cDNA, Clia Kits, Culture Cells, Devices, DNA, DNA Templates, DNA Testing, Elisa Kits, Enzymes, Equipments, Exosomes, Gels, Isotypes, Medium & Serums, NATtrol, Panel, Particles, PCR, Pcr Kits, Peptides, Reagents, Recombinant Proteins, Ria Kits, RNA, Test Kits, Vector & Virus, Western Blot
An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database.
An technique to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database.
A method to correlate the uninterpreted tandem mass spectra of peptides produced beneath low vitality (10-50 eV) collision circumstances with amino acid sequences throughout the Genpept database has been developed. On this system the protein database is searched to find out linear amino acid sequences inside a mass tolerance of ±1 u of the precursor ion molecular weight A cross-correlation function is then used to produce a measurement of similarity between the mass-to-charge ratios for the fragment ions predicted from amino acid sequences obtained from the database and the fragment ions seen throughout the tandem mass spectrum.
Usually, a distinction larger than 0.1 between the normalized cross-correlation options of the first- and second-ranked search outcomes signifies a worthwhile match between sequence and spectrum. Searches of species-specific protein databases with tandem mass spectra acquired from peptides obtained from the enzymatically digested complete proteins of E. coli and S.
cerevisiae cells allowed matching of the spectra to amino acid sequences inside proteins of these organisms. The technique described on this manuscript offers a useful methodology to interpret tandem mass spectra with acknowledged sequences in a protein database.
UHRF1BP1L siRNA |
20-abx938994 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UHRF1BP1L Antibody |
25349-100ul |
SAB |
100ul |
EUR 468 |
UHRF1BP1L Antibody |
6461-002mg |
ProSci |
0.02 mg |
EUR 206.18 |
- Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
|
Description: UHRF1BP1L Antibody: The Ubiquitin-like containing PHD and RING finger domains 1-binding protein 1-like (UHRF1BP1L) is closely related to UHRF1BP1, also known as ICBP90, a transcription and cell cycle regulator that specifically binds to the histone H3 N-terminal tail. While little is known of UHRF1BP1L, UHRF1BP1 is required for proper heterochromatin formation in mammalian cells. Furthermore, UHRF1BP1 is thought to be a pivotal target for the ERK1/2 signaling pathway to control the proliferation of Jurkat T cells, suggesting that UHRF1BP1L may also be involved in chromatin regulation and cell proliferation. |
UHRF1BP1L Antibody |
6461-01mg |
ProSci |
0.1 mg |
EUR 523.7 |
- Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
|
Description: UHRF1BP1L Antibody: The Ubiquitin-like containing PHD and RING finger domains 1-binding protein 1-like (UHRF1BP1L) is closely related to UHRF1BP1, also known as ICBP90, a transcription and cell cycle regulator that specifically binds to the histone H3 N-terminal tail. While little is known of UHRF1BP1L, UHRF1BP1 is required for proper heterochromatin formation in mammalian cells. Furthermore, UHRF1BP1 is thought to be a pivotal target for the ERK1/2 signaling pathway to control the proliferation of Jurkat T cells, suggesting that UHRF1BP1L may also be involved in chromatin regulation and cell proliferation. |
UHRF1BP1L Antibody |
1-CSB-PA025606LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
UHRF1BP1L Antibody |
E312594 |
EnoGene |
200ul |
EUR 275 |
Description: Available in various conjugation types. |
UHRF1BP1 Peptide |
6459P |
ProSci |
0.05 mg |
EUR 197.7 |
Description: (IN) UHRF1BP1 peptide |
anti- UHRF1BP1L antibody |
FNab09246 |
FN Test |
100µg |
EUR 702 |
- Recommended dilution: WB: 1:500-1:5000
- IP: 1:500-1:5000
- Immunogen: UHRF1 binding protein 1-like
- Uniprot ID: A0JNW5
- Gene ID: 23074
|
Description: Antibody raised against UHRF1BP1L |
UHRF1BP1L cloning plasmid |
CSB-CL025606HU1-10ug |
Cusabio |
10ug |
EUR 451.2 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1569
- Sequence: atggccgggatcatcaagaaacaaatcttgaagcacctctccagatttaccaaaaatttatctcctgacaagataaatctaagtacccttaaaggagaaggtgaactgaagaatttggagttggatgaagaagtactccagaatatgttggatttgccaacatggcttgctatca
- Show more
|
Description: A cloning plasmid for the UHRF1BP1L gene. |
UHRF1BP1L cloning plasmid |
CSB-CL025606HU2-10ug |
Cusabio |
10ug |
EUR 1308 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3033
- Sequence: ATGGCCGGGATCATCAAGAAACAAATCTTGAAGCACCTCTCCAGATTTACCAAAAATTTATCTCCTGACAAGATAAATCTAAGTACCCTTAAAGGAGAAGGTGAACTGAAGAATTTGGAGTTGGATGAAGAAGTACTCCAGAATATGTTGGATTTGCCAACATGGCTTGCTATCA
- Show more
|
Description: A cloning plasmid for the UHRF1BP1L gene. |
Polyclonal UHRF1BP1L Antibody |
APR06720G |
Leading Biology |
0.1 mg |
EUR 790.8 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UHRF1BP1L . This antibody is tested and proven to work in the following applications: |
UHRF1BP1L Polyclonal Antibody |
A61674 |
EpiGentek |
-
EUR 684.66
-
EUR 117.7
-
EUR 302.5
-
EUR 423.5
|
-
100 µg
-
20 ul
-
50 ul
-
100 ul
|
Human UHRF1BP1L shRNA Plasmid |
20-abx957978 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse UHRF1BP1L shRNA Plasmid |
20-abx978348 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Uhrf1bp1l ORF Vector (Rat) (pORF) |
ORF078615 |
ABM |
1.0 ug DNA |
EUR 2496 |
UHRF1BP1L Antibody, HRP conjugated |
1-CSB-PA025606LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
UHRF1BP1L ORF Vector (Human) (pORF) |
ORF014885 |
ABM |
1.0 ug DNA |
EUR 424.8 |
UHRF1BP1L ORF Vector (Human) (pORF) |
ORF011318 |
ABM |
1.0 ug DNA |
EUR 114 |
Uhrf1bp1l ORF Vector (Mouse) (pORF) |
ORF061024 |
ABM |
1.0 ug DNA |
EUR 1886.4 |
UHRF1BP1L Antibody, FITC conjugated |
1-CSB-PA025606LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
UHRF1BP1L Antibody, Biotin conjugated |
1-CSB-PA025606LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Uhrf1bp1l 3'UTR GFP Stable Cell Line |
TU272852 |
ABM |
1.0 ml |
Ask for price |
UHRF1BP1L 3'UTR GFP Stable Cell Line |
TU077815 |
ABM |
1.0 ml |
EUR 1672.8 |
Uhrf1bp1l 3'UTR GFP Stable Cell Line |
TU171570 |
ABM |
1.0 ml |
Ask for price |
UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody |
abx239246-100ug |
Abbexa |
100 ug |
EUR 661.2 |
- Shipped within 5-12 working days.
|
UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody |
abx028888-400ul |
Abbexa |
400 ul |
EUR 627.6 |
- Shipped within 5-10 working days.
|
UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody |
abx028888-80l |
Abbexa |
80 µl |
EUR 343.2 |
- Shipped within 5-10 working days.
|
UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody |
20-abx305894 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Uhrf1bp1l sgRNA CRISPR Lentivector set (Rat) |
K6609801 |
ABM |
3 x 1.0 ug |
EUR 406.8 |
UHRF1BP1L Protein Vector (Rat) (pPM-C-HA) |
PV314460 |
ABM |
500 ng |
EUR 2985.6 |
UHRF1BP1L Polyclonal Antibody, HRP Conjugated |
A61677 |
EpiGentek |
-
EUR 684.66
-
EUR 302.5
-
EUR 423.5
|
|
UHRF1BP1L Polyclonal Antibody, FITC Conjugated |
A61676 |
EpiGentek |
-
EUR 684.66
-
EUR 302.5
-
EUR 423.5
|
|
UHRF1BP1L Protein Vector (Rat) (pPB-C-His) |
PV314458 |
ABM |
500 ng |
EUR 2985.6 |
UHRF1BP1L Protein Vector (Rat) (pPB-N-His) |
PV314459 |
ABM |
500 ng |
EUR 2985.6 |
UHRF1BP1L Protein Vector (Rat) (pPM-C-His) |
PV314461 |
ABM |
500 ng |
EUR 2985.6 |
Uhrf1bp1l sgRNA CRISPR Lentivector set (Mouse) |
K4538801 |
ABM |
3 x 1.0 ug |
EUR 406.8 |
UHRF1BP1L sgRNA CRISPR Lentivector set (Human) |
K2586801 |
ABM |
3 x 1.0 ug |
EUR 406.8 |
UHRF1BP1L Protein Vector (Human) (pPM-C-HA) |
PV045271 |
ABM |
500 ng |
EUR 394.8 |
UHRF1BP1L Protein Vector (Human) (pPM-C-HA) |
PV059539 |
ABM |
500 ng |
EUR 577.2 |
UHRF1BP1L Protein Vector (Mouse) (pPM-C-HA) |
PV244096 |
ABM |
500 ng |
EUR 2966.4 |
UHRF1BP1L Polyclonal Antibody, Biotin Conjugated |
A61675 |
EpiGentek |
-
EUR 684.66
-
EUR 302.5
-
EUR 423.5
|
|
UHRF1BP1L Protein Vector (Human) (pPB-C-His) |
PV045269 |
ABM |
500 ng |
EUR 394.8 |
UHRF1BP1L Protein Vector (Human) (pPB-N-His) |
PV045270 |
ABM |
500 ng |
EUR 394.8 |
UHRF1BP1L Protein Vector (Human) (pPM-C-His) |
PV045272 |
ABM |
500 ng |
EUR 394.8 |
UHRF1BP1L Protein Vector (Human) (pPB-C-His) |
PV059537 |
ABM |
500 ng |
EUR 577.2 |
UHRF1BP1L Protein Vector (Human) (pPB-N-His) |
PV059538 |
ABM |
500 ng |
EUR 577.2 |
UHRF1BP1L Protein Vector (Human) (pPM-C-His) |
PV059540 |
ABM |
500 ng |
EUR 577.2 |
UHRF1BP1L Protein Vector (Mouse) (pPB-C-His) |
PV244094 |
ABM |
500 ng |
EUR 2966.4 |
UHRF1BP1L Protein Vector (Mouse) (pPB-N-His) |
PV244095 |
ABM |
500 ng |
EUR 2966.4 |
UHRF1BP1L Protein Vector (Mouse) (pPM-C-His) |
PV244097 |
ABM |
500 ng |
EUR 2966.4 |
Uhrf1bp1l 3'UTR Luciferase Stable Cell Line |
TU121570 |
ABM |
1.0 ml |
Ask for price |
UHRF1BP1L 3'UTR Luciferase Stable Cell Line |
TU027815 |
ABM |
1.0 ml |
EUR 1672.8 |
Uhrf1bp1l 3'UTR Luciferase Stable Cell Line |
TU222852 |
ABM |
1.0 ml |
Ask for price |
UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody (HRP) |
20-abx305895 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody (FITC) |
20-abx305896 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody (Biotin) |
20-abx305897 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human UHRF1-binding protein 1-like (UHRF1BP1L) ELISA Kit |
abx384123-96tests |
Abbexa |
96 tests |
EUR 1093.2 |
- Shipped within 5-12 working days.
|
Uhrf1bp1l sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6609802 |
ABM |
1.0 ug DNA |
EUR 184.8 |
Uhrf1bp1l sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6609803 |
ABM |
1.0 ug DNA |
EUR 184.8 |
Uhrf1bp1l sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6609804 |
ABM |
1.0 ug DNA |
EUR 184.8 |
Mouse UHRF1- binding protein 1- like, Uhrf1bp1l ELISA KIT |
ELI-36748m |
Lifescience Market |
96 Tests |
EUR 1038 |
Human UHRF1- binding protein 1- like, UHRF1BP1L ELISA KIT |
ELI-44737h |
Lifescience Market |
96 Tests |
EUR 988.8 |
Uhrf1bp1l sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4538802 |
ABM |
1.0 ug DNA |
EUR 184.8 |
Uhrf1bp1l sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4538803 |
ABM |
1.0 ug DNA |
EUR 184.8 |
Uhrf1bp1l sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4538804 |
ABM |
1.0 ug DNA |
EUR 184.8 |
UHRF1BP1L sgRNA CRISPR Lentivector (Human) (Target 1) |
K2586802 |
ABM |
1.0 ug DNA |
EUR 184.8 |
UHRF1BP1L sgRNA CRISPR Lentivector (Human) (Target 2) |
K2586803 |
ABM |
1.0 ug DNA |
EUR 184.8 |
UHRF1BP1L sgRNA CRISPR Lentivector (Human) (Target 3) |
K2586804 |
ABM |
1.0 ug DNA |
EUR 184.8 |
UHRF1BP1L Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV620737 |
ABM |
1.0 ug DNA |
EUR 2790 |
UHRF1BP1L Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV620741 |
ABM |
1.0 ug DNA |
EUR 2790 |
UHRF1BP1L Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV704649 |
ABM |
1.0 ug DNA |
EUR 540 |
UHRF1BP1L Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV704653 |
ABM |
1.0 ug DNA |
EUR 540 |
UHRF1BP1L Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV620742 |
ABM |
1.0 ug DNA |
EUR 2790 |
UHRF1BP1L Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV704654 |
ABM |
1.0 ug DNA |
EUR 540 |
Uhrf1bp1l sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat) |
K6609805 |
ABM |
3 x 1.0 ug |
EUR 451.2 |
Uhrf1bp1l sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse) |
K4538805 |
ABM |
3 x 1.0 ug |
EUR 451.2 |
UHRF1BP1L sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
K2586805 |
ABM |
3 x 1.0 ug |
EUR 451.2 |
Uhrf1bp1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1) |
K6609806 |
ABM |
1.0 ug DNA |
EUR 200.4 |
Uhrf1bp1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2) |
K6609807 |
ABM |
1.0 ug DNA |
EUR 200.4 |
Uhrf1bp1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3) |
K6609808 |
ABM |
1.0 ug DNA |
EUR 200.4 |
Uhrf1bp1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1) |
K4538806 |
ABM |
1.0 ug DNA |
EUR 200.4 |
Uhrf1bp1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2) |
K4538807 |
ABM |
1.0 ug DNA |
EUR 200.4 |
Uhrf1bp1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3) |
K4538808 |
ABM |
1.0 ug DNA |
EUR 200.4 |
UHRF1BP1L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K2586806 |
ABM |
1.0 ug DNA |
EUR 200.4 |
UHRF1BP1L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
K2586807 |
ABM |
1.0 ug DNA |
EUR 200.4 |
UHRF1BP1L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K2586808 |
ABM |
1.0 ug DNA |
EUR 200.4 |
CHARMM: the biomolecular simulation program.
CHARMM (Chemistry at HARvard Molecular Mechanics) is a extraordinarily versatile and broadly used molecular simulation program.
It has been developed over the previous three a few years with a primary give consideration to molecules of natural curiosity, along with proteins, peptides, lipids, nucleic acids, carbohydrates, and small molecule ligands, as they occur in reply, crystals, and membrane environments.
For the look at of such methods, this method offers a giant suite of computational devices that embrace fairly just a few conformational and path sampling methods, free vitality estimators, molecular minimization, dynamics, and analysis strategies, and model-building capabilities.
The CHARMM program is related to points involving a a lot wider class of many-particle methods.
Calculations with CHARMM could also be carried out using numerous fully totally different vitality options and fashions, from blended quantum mechanical-molecular mechanical stress fields, to all-atom classical potential vitality options with particular solvent and quite a few boundary circumstances, to implicit solvent and membrane fashions.
This method has been ported to fairly just a few platforms in every serial and parallel architectures. This textual content offers an overview of this method as a result of it exists within the current day with an emphasis on developments as a result of the publication of the distinctive CHARMM article in 1983.
Ghrelin is a growth-hormone-releasing acylated peptide from stomach.
Small synthetic molecules often known as growth-hormone secretagogues (GHSs) stimulate the discharge of improvement hormone (GH) from the pituitary. They act by means of GHS-R, a G-protein-coupled receptor for which the ligand is unknown.
Present cloning of GHS-R strongly implies that an endogenous ligand for the receptor does exist and that there is a mechanism for regulating GH launch that is distinct from its regulation by hypothalamic growth-hormone-releasing hormone (GHRH).
We now report the purification and identification in rat stomach of an endogenous ligand explicit for GHS-R.
The purified ligand is a peptide of 28 amino acids, by which the serine three residue is n-octanoylated. The acylated peptide notably releases GH every in vivo and in vitro, and O-n-octanoylation at serine three is essential for the train.
We designate the GH-releasing peptide ‘ghrelin’ (ghre is the Proto-Indo-European root of the phrase ‘develop’). Human ghrelin is homologous to rat ghrelin apart from two amino acids.
The incidence of ghrelin in every rat and human signifies that GH launch from the pituitary may be regulated not solely by hypothalamic GHRH, however as well as by ghrelin.
anti-Macrophage Inflammatory Protein 1 beta |
YF-PA14543 |
Abfrontier |
100 ug |
EUR 483.6 |
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 1 beta |
anti-Macrophage inflammatory protein 5 |
YF-PA20144 |
Abfrontier |
50 ug |
EUR 435.6 |
Description: Mouse polyclonal to Macrophage inflammatory protein 5 |
anti-Macrophage inflammatory protein 5 |
YF-PA20145 |
Abfrontier |
100 ul |
EUR 483.6 |
Description: Rabbit polyclonal to Macrophage inflammatory protein 5 |
anti-Macrophage inflammatory protein 5 |
YF-PA20146 |
Abfrontier |
100 ug |
EUR 483.6 |
Description: Rabbit polyclonal to Macrophage inflammatory protein 5 |
anti-Macrophage inflammatory protein 5 |
YF-PA14551 |
Abfrontier |
100 ul |
EUR 483.6 |
Description: Rabbit polyclonal to Macrophage inflammatory protein 5 |
anti-Macrophage inflammatory protein 5 |
YF-PA14552 |
Abfrontier |
100 ug |
EUR 483.6 |
Description: Rabbit polyclonal to Macrophage inflammatory protein 5 |
anti-Macrophage Inflammatory Protein 4 |
YF-PA14553 |
Abfrontier |
100 ul |
EUR 483.6 |
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 4 |
anti-Macrophage Inflammatory Protein 4 |
YF-PA14554 |
Abfrontier |
100 ug |
EUR 483.6 |
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 4 |
anti-Macrophage Inflammatory Protein 3 |
YF-PA14559 |
Abfrontier |
50 ug |
EUR 435.6 |
Description: Mouse polyclonal to Macrophage Inflammatory Protein 3 |
anti-Macrophage Inflammatory Protein 3 |
YF-PA14560 |
Abfrontier |
100 ul |
EUR 483.6 |
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 3 |
anti-Macrophage Inflammatory Protein 3 |
YF-PA14561 |
Abfrontier |
100 ug |
EUR 483.6 |
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 3 |
anti-Macrophage inflammatory protein 5 |
YF-PA24672 |
Abfrontier |
50 ul |
EUR 400.8 |
Description: Mouse polyclonal to Macrophage inflammatory protein 5 |
anti-Macrophage Inflammatory Protein 4 |
YF-PA24674 |
Abfrontier |
50 ul |
EUR 400.8 |
Description: Mouse polyclonal to Macrophage Inflammatory Protein 4 |
Inflammatory profilin Antibody |
20-abx110412 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Macrophage inflammatory protein 5 (1D7) |
YF-MA15363 |
Abfrontier |
100 ug |
EUR 435.6 |
Description: Mouse monoclonal to Macrophage inflammatory protein 5 |
Anti-Macrophage inflammatory protein 5 (3H1) |
YF-MA15365 |
Abfrontier |
100 ug |
EUR 435.6 |
Description: Mouse monoclonal to Macrophage inflammatory protein 5 |
Anti-Macrophage inflammatory protein 5 (3B7) |
YF-MA15366 |
Abfrontier |
100 ug |
EUR 435.6 |
Description: Mouse monoclonal to Macrophage inflammatory protein 5 |
Anti-Macrophage inflammatory protein 5 (3B1) |
YF-MA15367 |
Abfrontier |
100 ug |
EUR 435.6 |
Description: Mouse monoclonal to Macrophage inflammatory protein 5 |
Anti-Macrophage Inflammatory Protein 4 (2C6) |
YF-MA15369 |
Abfrontier |
100 ug |
EUR 435.6 |
Description: Mouse monoclonal to Macrophage Inflammatory Protein 4 |
Anti-Macrophage inflammatory protein 5 (3D3) |
YF-MA19031 |
Abfrontier |
100 ug |
EUR 435.6 |
Description: Mouse monoclonal to Macrophage inflammatory protein 5 |
Anti-Macrophage inflammatory protein 5 (4G10) |
YF-MA15364 |
Abfrontier |
100 ug |
EUR 435.6 |
Description: Mouse monoclonal to Macrophage inflammatory protein 5 |
Anti-Macrophage Inflammatory Protein 1 beta?/CCL4 Antibody |
PB9572 |
BosterBio |
100ug/vial |
EUR 352.8 |
Anti-Macrophage Inflammatory Protein 1 beta/CCL4 Antibody |
PB9064 |
BosterBio |
100ug/vial |
EUR 352.8 |
Anti-Macrophage Inflammatory Protein 1 beta/CCL4 Antibody |
PA1379 |
BosterBio |
100ug/vial |
EUR 352.8 |
Allograft Inflammatory Factor 1 Protein |
20-abx262211 |
Abbexa |
-
EUR 393.6
-
EUR 6991.2
-
EUR 276
|
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx109516 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx103213 |
Abbexa |
-
EUR 393.6
-
EUR 159.6
-
EUR 1078.8
-
EUR 543.6
-
EUR 343.2
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx103214 |
Abbexa |
-
EUR 360
-
EUR 844.8
-
EUR 427.2
-
EUR 184.8
-
EUR 292.8
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx103215 |
Abbexa |
-
EUR 376.8
-
EUR 159.6
-
EUR 994.8
-
EUR 526.8
-
EUR 326.4
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx103216 |
Abbexa |
-
EUR 543.6
-
EUR 159.6
-
EUR 1562.4
-
EUR 744
-
EUR 410.4
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx104925 |
Abbexa |
-
EUR 560.4
-
EUR 159.6
-
EUR 1629.6
-
EUR 777.6
-
EUR 427.2
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx175326 |
Abbexa |
-
EUR 393.6
-
EUR 159.6
-
EUR 1078.8
-
EUR 543.6
-
EUR 326.4
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx175327 |
Abbexa |
|
|
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx214166 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx214538 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx109254 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx110941 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
abx025719-400ul |
Abbexa |
400 ul |
EUR 627.6 |
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
abx025719-80l |
Abbexa |
80 µl |
EUR 343.2 |
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
abx037687-100ug |
Abbexa |
100 ug |
EUR 469.2 |
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
abx037794-100ug |
Abbexa |
100 ug |
EUR 469.2 |
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx131921 |
Abbexa |
-
EUR 427.2
-
EUR 1095.6
-
EUR 560.4
-
EUR 184.8
-
EUR 326.4
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Allograft Inflammatory Factor 1 (Aif1) Antibody |
20-abx319635 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx001285 |
Abbexa |
-
EUR 493.2
-
EUR 710.4
-
EUR 218.4
-
EUR 376.8
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Inflammatory profilin Antibody (HRP) |
20-abx108966 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-CCL3/Macrophage Inflammatory Protein 1 alpha Antibody |
PB9571 |
BosterBio |
100ug/vial |
EUR 352.8 |
Anti-CCL3/Macrophage Inflammatory Protein 1 alpha Antibody |
PB9022 |
BosterBio |
100ug/vial |
EUR 352.8 |
Inflammatory profilin Antibody (FITC) |
20-abx107547 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rat Allograft inflammatory factor 1 (Aif1) |
1-CSB-YP001490RA |
Cusabio |
-
EUR 604.8
-
EUR 318
-
EUR 2198.4
-
EUR 915.6
-
EUR 1459.2
-
EUR 400.8
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 18.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Rat Allograft inflammatory factor 1(Aif1) expressed in Yeast |
Rat Allograft inflammatory factor 1 (Aif1) |
1-CSB-EP001490RA |
Cusabio |
-
EUR 606
-
EUR 318
-
EUR 2192.4
-
EUR 919.2
-
EUR 1461.6
-
EUR 402
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 32.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Rat Allograft inflammatory factor 1(Aif1) expressed in E.coli |
Anti-Macrophage Inflammatory Protein 3 beta (3E9) |
YF-MA15370 |
Abfrontier |
200 ul |
EUR 435.6 |
Description: Mouse monoclonal to Macrophage Inflammatory Protein 3 beta |
Inflammatory profilin Antibody (Biotin) |
20-abx106133 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human Allograft inflammatory factor 1 (AIF1) |
1-CSB-EP001490HU |
Cusabio |
-
EUR 456
-
EUR 256.8
-
EUR 1570.8
-
EUR 672
-
EUR 1047.6
-
EUR 314.4
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 32.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Allograft inflammatory factor 1(AIF1),partial expressed in E.coli |
Mouse Allograft inflammatory factor 1 (Aif1) |
1-CSB-EP001490MO |
Cusabio |
-
EUR 606
-
EUR 318
-
EUR 2192.4
-
EUR 919.2
-
EUR 1461.6
-
EUR 402
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 20.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Allograft inflammatory factor 1(Aif1) expressed in E.coli |
Allograft Inflammatory Factor 1 (AIF1) Antibody (HRP) |
20-abx107953 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody (HRP) |
20-abx107954 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (Aif1) Antibody (HRP) |
20-abx319636 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody (FITC) |
20-abx106536 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody (FITC) |
20-abx106537 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody Pair |
20-abx370492 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody Pair |
20-abx370845 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-12 working days.
|
Allograft Inflammatory Factor 1 (Aif1) Antibody (FITC) |
20-abx319637 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody (FITC) |
20-abx273634 |
Abbexa |
-
EUR 427.2
-
EUR 276
-
EUR 1245.6
-
EUR 627.6
-
EUR 360
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody (FITC) |
20-abx274375 |
Abbexa |
-
EUR 393.6
-
EUR 243.6
-
EUR 978
-
EUR 510
-
EUR 343.2
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Allograft Inflammatory Factor 1 Like Protein |
20-abx260692 |
Abbexa |
-
EUR 4101.6
-
EUR 393.6
-
EUR 276
|
|
- Shipped within 5-10 working days.
|
Human Macrophage Inflammatory Protein-1 beta |
90218-A |
BPS Bioscience |
2 µg |
EUR 130 |
Description: Recombinant MIP-1 beta is a disulfide-linked homodimeric protein consisting of 70 amino acid residues, and migrates as an approximately 8 kDa protein under non-reducing and reducing conditions in SDS-PAGE. Optimized DNA sequence encoding Human MIP-1 beta chain was expressed in E. coli. |
Human Macrophage Inflammatory Protein-1 beta |
90218-B |
BPS Bioscience |
10 µg |
EUR 205 |
Description: Recombinant MIP-1 beta is a disulfide-linked homodimeric protein consisting of 70 amino acid residues, and migrates as an approximately 8 kDa protein under non-reducing and reducing conditions in SDS-PAGE. Optimized DNA sequence encoding Human MIP-1 beta chain was expressed in E. coli. |
Anti-Macrophage Inflammatory Protein 4/CCL18 Antibody |
PB9023 |
BosterBio |
100ug/vial |
EUR 352.8 |
Rat Allograft Inflammatory Factor 1 ELISA kit |
E02A0627-192T |
BlueGene |
192 tests |
EUR 1524 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Allograft Inflammatory Factor 1 ELISA kit |
E02A0627-48 |
BlueGene |
1 plate of 48 wells |
EUR 624 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Allograft Inflammatory Factor 1 ELISA kit |
E02A0627-96 |
BlueGene |
1 plate of 96 wells |
EUR 822 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Allograft Inflammatory Factor 1 ELISA kit |
E07A0627-192T |
BlueGene |
192 tests |
EUR 1524 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Allograft Inflammatory Factor 1 ELISA kit |
E07A0627-48 |
BlueGene |
1 plate of 48 wells |
EUR 624 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Allograft Inflammatory Factor 1 ELISA kit |
E07A0627-96 |
BlueGene |
1 plate of 96 wells |
EUR 822 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Allograft Inflammatory Factor 1 ELISA kit |
E08A0627-192T |
BlueGene |
192 tests |
EUR 1524 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Allograft Inflammatory Factor 1 ELISA kit |
E08A0627-48 |
BlueGene |
1 plate of 48 wells |
EUR 624 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Allograft Inflammatory Factor 1 ELISA kit |
E08A0627-96 |
BlueGene |
1 plate of 96 wells |
EUR 822 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin) |
20-abx105119 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin) |
20-abx105120 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (Aif1) Antibody (Biotin) |
20-abx319638 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin) |
20-abx272264 |
Abbexa |
-
EUR 410.4
-
EUR 260.4
-
EUR 1161.6
-
EUR 594
-
EUR 343.2
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin) |
20-abx272826 |
Abbexa |
-
EUR 560.4
-
EUR 292.8
-
EUR 1612.8
-
EUR 760.8
-
EUR 410.4
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin) |
20-abx273401 |
Abbexa |
-
EUR 577.2
-
EUR 292.8
-
EUR 1696.8
-
EUR 794.4
-
EUR 427.2
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin) |
20-abx274328 |
Abbexa |
-
EUR 376.8
-
EUR 243.6
-
EUR 910.8
-
EUR 493.2
-
EUR 326.4
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin) |
20-abx274640 |
Abbexa |
-
EUR 477.6
-
EUR 260.4
-
EUR 1178.4
-
EUR 594
-
EUR 376.8
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Macrophage Inflammatory protein-1 alpha |
90217-A |
BPS Bioscience |
5 µg |
EUR 130 |
Description: Recombinant MIP-1 alpha is a disulfide-linked homodimeric protein consisting of 70 amino acid residues, and migrates as an approximately 8 kDa protein under non-reducing and reducing conditions in SDS-PAGE. Optimized DNA sequence encoding Human MIP-1 alpha chain was expressed in E. coli. |
Human Macrophage Inflammatory protein-1 alpha |
90217-B |
BPS Bioscience |
20 µg |
EUR 205 |
Description: Recombinant MIP-1 alpha is a disulfide-linked homodimeric protein consisting of 70 amino acid residues, and migrates as an approximately 8 kDa protein under non-reducing and reducing conditions in SDS-PAGE. Optimized DNA sequence encoding Human MIP-1 alpha chain was expressed in E. coli. |
Goat Allograft Inflammatory Factor 1 ELISA kit |
E06A0627-192T |
BlueGene |
192 tests |
EUR 1524 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Allograft Inflammatory Factor 1 ELISA kit |
E06A0627-48 |
BlueGene |
1 plate of 48 wells |
EUR 624 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Allograft Inflammatory Factor 1 ELISA kit |
E06A0627-96 |
BlueGene |
1 plate of 96 wells |
EUR 822 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Allograft Inflammatory Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Macrophage Inflammatory Protein 1 Beta (MIP1b) Antibody |
20-abx313218 |
Abbexa |
-
EUR 493.2
-
EUR 2214
-
EUR 718.8
-
EUR 218.4
-
EUR 360
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Macrophage Inflammatory Protein 1 Beta (MIP1b) Antibody |
20-abx104064 |
Abbexa |
-
EUR 376.8
-
EUR 159.6
-
EUR 978
-
EUR 510
-
EUR 326.4
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Macrophage Inflammatory Protein 1 Beta (MIP1b) Antibody |
20-abx104065 |
Abbexa |
-
EUR 510
-
EUR 159.6
-
EUR 1412.4
-
EUR 693.6
-
EUR 393.6
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Macrophage Inflammatory Protein 1 Beta (MIP1b) Antibody |
20-abx104066 |
Abbexa |
-
EUR 526.8
-
EUR 159.6
-
EUR 1479.6
-
EUR 710.4
-
EUR 393.6
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|