An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database.

microbiologystudents

An technique to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database.

A method to correlate the uninterpreted tandem mass spectra of peptides produced beneath low vitality (10-50 eV) collision circumstances with amino acid sequences throughout the Genpept database has been developed. On this system the protein database is searched to find out linear amino acid sequences inside a mass tolerance of ±1 u of the precursor ion molecular weight A cross-correlation function is then used to produce a measurement of similarity between the mass-to-charge ratios for the fragment ions predicted from amino acid sequences obtained from the database and the fragment ions seen throughout the tandem mass spectrum.

 

Usually, a distinction larger than 0.1 between the normalized cross-correlation options of the first- and second-ranked search outcomes signifies a worthwhile match between sequence and spectrum. Searches of species-specific protein databases with tandem mass spectra acquired from peptides obtained from the enzymatically digested complete proteins of E. coli and S.

 

cerevisiae cells allowed matching of the spectra to amino acid sequences inside proteins of these organisms. The technique described on this manuscript offers a useful methodology to interpret tandem mass spectra with acknowledged sequences in a protein database.

 

UHRF1BP1L

CSB-CL025606HU2 10 μg plasmid + 200μl Glycerol Ask for price

UHRF1BP1L siRNA

20-abx938993
  • Ask for price
  • Ask for price
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UHRF1BP1L siRNA

20-abx938994
  • Ask for price
  • Ask for price
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UHRF1BP1L Antibody

6461-002mg 0.02 mg
EUR 206.18
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: UHRF1BP1L Antibody: The Ubiquitin-like containing PHD and RING finger domains 1-binding protein 1-like (UHRF1BP1L) is closely related to UHRF1BP1, also known as ICBP90, a transcription and cell cycle regulator that specifically binds to the histone H3 N-terminal tail. While little is known of UHRF1BP1L, UHRF1BP1 is required for proper heterochromatin formation in mammalian cells. Furthermore, UHRF1BP1 is thought to be a pivotal target for the ERK1/2 signaling pathway to control the proliferation of Jurkat T cells, suggesting that UHRF1BP1L may also be involved in chromatin regulation and cell proliferation.

UHRF1BP1L Antibody

6461-01mg 0.1 mg
EUR 523.7
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: UHRF1BP1L Antibody: The Ubiquitin-like containing PHD and RING finger domains 1-binding protein 1-like (UHRF1BP1L) is closely related to UHRF1BP1, also known as ICBP90, a transcription and cell cycle regulator that specifically binds to the histone H3 N-terminal tail. While little is known of UHRF1BP1L, UHRF1BP1 is required for proper heterochromatin formation in mammalian cells. Furthermore, UHRF1BP1 is thought to be a pivotal target for the ERK1/2 signaling pathway to control the proliferation of Jurkat T cells, suggesting that UHRF1BP1L may also be involved in chromatin regulation and cell proliferation.

UHRF1BP1L Antibody

25349 100ul
EUR 479

UHRF1BP1L Antibody

25349-100ul 100ul
EUR 468

UHRF1BP1L Antibody

1-CSB-PA025606LA01HU
  • Ask for price
  • Ask for price
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is Unconjugated. Tested in the following application: ELISA

UHRF1BP1L Antibody

E312594 200ul
EUR 275
Description: Available in various conjugation types.

Uhrf1bp1l (untagged ORF) - Rat UHRF1 binding protein 1-like (Uhrf1bp1l), (10 ug)

RN206432 10 µg Ask for price

Uhrf1bp1l (untagged) - Mouse UHRF1 (ICBP90) binding protein 1-like (Uhrf1bp1l), (10ug)

MC224500 10 µg Ask for price

anti- UHRF1BP1L antibody

FNab09246 100µg
EUR 702
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:500-1:5000
  • Immunogen: UHRF1 binding protein 1-like
  • Uniprot ID: A0JNW5
  • Gene ID: 23074
Description: Antibody raised against UHRF1BP1L

UHRF1BP1L cloning plasmid

CSB-CL025606HU1-10ug 10ug
EUR 451.2
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1569
  • Sequence: atggccgggatcatcaagaaacaaatcttgaagcacctctccagatttaccaaaaatttatctcctgacaagataaatctaagtacccttaaaggagaaggtgaactgaagaatttggagttggatgaagaagtactccagaatatgttggatttgccaacatggcttgctatca
  • Show more
Description: A cloning plasmid for the UHRF1BP1L gene.

UHRF1BP1L cloning plasmid

CSB-CL025606HU2-10ug 10ug
EUR 1308
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3033
  • Sequence: ATGGCCGGGATCATCAAGAAACAAATCTTGAAGCACCTCTCCAGATTTACCAAAAATTTATCTCCTGACAAGATAAATCTAAGTACCCTTAAAGGAGAAGGTGAACTGAAGAATTTGGAGTTGGATGAAGAAGTACTCCAGAATATGTTGGATTTGCCAACATGGCTTGCTATCA
  • Show more
Description: A cloning plasmid for the UHRF1BP1L gene.

Uhrf1bp1l (Myc-DDK-tagged) - Mouse UHRF1 (ICBP90) binding protein 1-like (Uhrf1bp1l)

MR217370 10 µg Ask for price

Uhrf1bp1l (GFP-tagged) - Mouse UHRF1 (ICBP90) binding protein 1-like (Uhrf1bp1l), (10ug)

MG217370 10 µg Ask for price

UHRF1BP1 Peptide

6459P 0.05 mg
EUR 197.7
Description: (IN) UHRF1BP1 peptide

UHRF1BP1L ELISA KIT|Human

EF004066 96 Tests
EUR 826.8

UHRF1BP1L (untagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 1

SC304212 10 µg Ask for price

UHRF1BP1L (untagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 2

SC301130 10 µg Ask for price

Uhrf1bp1l (Myc-DDK-tagged ORF) - Rat UHRF1 binding protein 1-like (Uhrf1bp1l), (10 ug)

RR206432 10 µg Ask for price

Polyclonal UHRF1BP1L Antibody

APR06720G 0.1 mg
EUR 790.8
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UHRF1BP1L . This antibody is tested and proven to work in the following applications:

UHRF1BP1L Polyclonal Antibody

A61674
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 µg
  • 20 ul
  • 50 ul
  • 100 ul

UHRF1BP1L (GFP-tagged) - Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 1

RG217227 10 µg Ask for price

UHRF1BP1L (GFP-tagged) - Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 2

RG221416 10 µg Ask for price

Human UHRF1BP1L shRNA Plasmid

20-abx957978
  • Ask for price
  • Ask for price
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse UHRF1BP1L shRNA Plasmid

20-abx978348
  • Ask for price
  • Ask for price
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Uhrf1bp1l ORF Vector (Rat) (pORF)

ORF078615 1.0 ug DNA
EUR 2496

UHRF1BP1L (Myc-DDK-tagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 2

RC221416 10 µg Ask for price

UHRF1BP1L (Myc-DDK-tagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 1

RC217227 10 µg Ask for price

Lenti ORF clone of Uhrf1bp1l (mGFP-tagged) - Mouse UHRF1 (ICBP90) binding protein 1-like (Uhrf1bp1l)

MR217370L4 10 µg Ask for price

UHRF1BP1L Antibody, HRP conjugated

1-CSB-PA025606LB01HU
  • Ask for price
  • Ask for price
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

Uhrf1bp1l ORF Vector (Mouse) (pORF)

ORF061024 1.0 ug DNA
EUR 1886.4

UHRF1BP1L ORF Vector (Human) (pORF)

ORF014885 1.0 ug DNA
EUR 424.8

UHRF1BP1L ORF Vector (Human) (pORF)

ORF011318 1.0 ug DNA
EUR 114

UHRF1BP1L Antibody, FITC conjugated

1-CSB-PA025606LC01HU
  • Ask for price
  • Ask for price
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

Lenti ORF clone of Uhrf1bp1l (Myc-DDK-tagged) - Mouse UHRF1 (ICBP90) binding protein 1-like (Uhrf1bp1l)

MR217370L3 10 µg Ask for price

UHRF1BP1L Antibody, Biotin conjugated

1-CSB-PA025606LD01HU
  • Ask for price
  • Ask for price
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rabbit Polyclonal UHRF1BP1L Antibody

TA319842 100 µg Ask for price

Human UHRF1BP1L knockout cell line

ABC-KH16531 1 vial Ask for price
Description: Human UHRF1BP1L knockout cell line is HEK293/HeLa cell line, edited by CRISPR/Cas9 technology.

Lenti ORF particles, Uhrf1bp1l (GFP-tagged) - Mouse UHRF1 (ICBP90) binding protein 1-like (Uhrf1bp1l), 200ul, >10^7 TU/mL

MR217370L4V 200 µl Ask for price

Human UHRF1BP1L knockdown cell line

ABC-KD16531 1 vial Ask for price
Description: Human UHRF1BP1L knockdown cell line is engineered by our optimized transduction of the specific shRNA with lentivirus. Knockdown levels are determined via qRT-PCR. Gentaur offers generation of stable knockdown (RNAi) cell lines expressing shRNAs targeting genes of your interest.

Lenti-ORF clone of UHRF1BP1L (mGFP-tagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 2

RC221416L4 10 µg Ask for price

Lenti-ORF clone of UHRF1BP1L (mGFP-tagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 1

RC217227L4 10 µg Ask for price

Lenti ORF particles, Uhrf1bp1l (Myc-DDK-tagged) - Mouse UHRF1 (ICBP90) binding protein 1-like (Uhrf1bp1l), 200ul, >10^7 TU/mL

MR217370L3V 200 µl Ask for price

UHRF1BP1L 3'UTR GFP Stable Cell Line

TU077815 1.0 ml
EUR 1672.8

Uhrf1bp1l 3'UTR GFP Stable Cell Line

TU171570 1.0 ml Ask for price

Uhrf1bp1l 3'UTR GFP Stable Cell Line

TU272852 1.0 ml Ask for price

Lenti-ORF clone of UHRF1BP1L (Myc-DDK-tagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 2

RC221416L3 10 µg Ask for price

Lenti-ORF clone of UHRF1BP1L (Myc-DDK-tagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 1

RC217227L3 10 µg Ask for price

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody

20-abx305894
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody

abx239246-100ug 100 ug
EUR 661.2
  • Shipped within 5-12 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody

abx028888-400ul 400 ul
EUR 627.6
  • Shipped within 5-10 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody

abx028888-80l 80 µl
EUR 343.2
  • Shipped within 5-10 working days.

UHRF1BP1L Polyclonal Antibody, HRP Conjugated

A61677
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 µg
  • 50 ul
  • 100 ul

Uhrf1bp1l sgRNA CRISPR Lentivector set (Rat)

K6609801 3 x 1.0 ug
EUR 406.8

UHRF1BP1L Protein Vector (Rat) (pPM-C-HA)

PV314460 500 ng
EUR 2985.6

UHRF1BP1L Polyclonal Antibody, FITC Conjugated

A61676
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 µg
  • 50 ul
  • 100 ul

UHRF1BP1L Protein Vector (Rat) (pPB-C-His)

PV314458 500 ng
EUR 2985.6

UHRF1BP1L Protein Vector (Rat) (pPB-N-His)

PV314459 500 ng
EUR 2985.6

UHRF1BP1L Protein Vector (Rat) (pPM-C-His)

PV314461 500 ng
EUR 2985.6

Uhrf1bp1l sgRNA CRISPR Lentivector set (Mouse)

K4538801 3 x 1.0 ug
EUR 406.8

UHRF1BP1L sgRNA CRISPR Lentivector set (Human)

K2586801 3 x 1.0 ug
EUR 406.8

UHRF1BP1L Protein Vector (Human) (pPM-C-HA)

PV045271 500 ng
EUR 394.8

UHRF1BP1L Protein Vector (Human) (pPM-C-HA)

PV059539 500 ng
EUR 577.2

UHRF1BP1L Protein Vector (Mouse) (pPM-C-HA)

PV244096 500 ng
EUR 2966.4

UHRF1BP1L Polyclonal Antibody, Biotin Conjugated

A61675
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 µg
  • 50 ul
  • 100 ul

Lenti ORF particles, UHRF1BP1L (mGFP-tagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 2, 200ul, >10^7 TU/mL

RC221416L4V 200 µl Ask for price

Lenti ORF particles, UHRF1BP1L (mGFP-tagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 1, 200ul, >10^7 TU/mL

RC217227L4V 200 µl Ask for price

UHRF1BP1L Protein Vector (Human) (pPB-C-His)

PV045269 500 ng
EUR 394.8

UHRF1BP1L Protein Vector (Human) (pPB-N-His)

PV045270 500 ng
EUR 394.8

UHRF1BP1L Protein Vector (Human) (pPM-C-His)

PV045272 500 ng
EUR 394.8

UHRF1BP1L Protein Vector (Human) (pPB-C-His)

PV059537 500 ng
EUR 577.2

UHRF1BP1L Protein Vector (Human) (pPB-N-His)

PV059538 500 ng
EUR 577.2

UHRF1BP1L Protein Vector (Human) (pPM-C-His)

PV059540 500 ng
EUR 577.2

UHRF1BP1L Protein Vector (Mouse) (pPB-C-His)

PV244094 500 ng
EUR 2966.4

UHRF1BP1L Protein Vector (Mouse) (pPB-N-His)

PV244095 500 ng
EUR 2966.4

UHRF1BP1L Protein Vector (Mouse) (pPM-C-His)

PV244097 500 ng
EUR 2966.4

Uhrf1bp1l 3'UTR Luciferase Stable Cell Line

TU121570 1.0 ml Ask for price

UHRF1BP1L 3'UTR Luciferase Stable Cell Line

TU027815 1.0 ml
EUR 1672.8

Uhrf1bp1l 3'UTR Luciferase Stable Cell Line

TU222852 1.0 ml Ask for price

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody (HRP)

20-abx305895
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody (FITC)

20-abx305896
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody (Biotin)

20-abx305897
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lenti ORF particles, UHRF1BP1L (Myc-DDK-tagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 2, 200ul, >10^7 TU/mL

RC221416L3V 200 µl Ask for price

Lenti ORF particles, UHRF1BP1L (Myc-DDK-tagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 1, 200ul, >10^7 TU/mL

RC217227L3V 200 µl Ask for price

OAPB01468-100UG - UHRF1BP1L Antibody - N-terminal

OAPB01468-100UG 100ug
EUR 389
  • UHRF1BP1L Antibody - N-terminal

 

CHARMM: the biomolecular simulation program.

CHARMM (Chemistry at HARvard Molecular Mechanics) is a extraordinarily versatile and broadly used molecular simulation program.

It has been developed over the previous three a few years with a primary give consideration to molecules of natural curiosity, along with proteins, peptides, lipids, nucleic acids, carbohydrates, and small molecule ligands, as they occur in reply, crystals, and membrane environments.

For the look at of such methods, this method offers a giant suite of computational devices that embrace fairly just a few conformational and path sampling methods, free vitality estimators, molecular minimization, dynamics, and analysis strategies, and model-building capabilities.

The CHARMM program is related to points involving a a lot wider class of many-particle methods.

Calculations with CHARMM could also be carried out using numerous fully totally different vitality options and fashions, from blended quantum mechanical-molecular mechanical stress fields, to all-atom classical potential vitality options with particular solvent and quite a few boundary circumstances, to implicit solvent and membrane fashions.

This method has been ported to fairly just a few platforms in every serial and parallel architectures. This textual content offers an overview of this method as a result of it exists within the current day with an emphasis on developments as a result of the publication of the distinctive CHARMM article in 1983.

 

Ghrelin is a growth-hormone-releasing acylated peptide from stomach.

 

Small synthetic molecules often known as growth-hormone secretagogues (GHSs) stimulate the discharge of improvement hormone (GH) from the pituitary. They act by means of GHS-R, a G-protein-coupled receptor for which the ligand is unknown.

Present cloning of GHS-R strongly implies that an endogenous ligand for the receptor does exist and that there is a mechanism for regulating GH launch that is distinct from its regulation by hypothalamic growth-hormone-releasing hormone (GHRH).

 

We now report the purification and identification in rat stomach of an endogenous ligand explicit for GHS-R.

The purified ligand is a peptide of 28 amino acids, by which the serine three residue is n-octanoylated. The acylated peptide notably releases GH every in vivo and in vitro, and O-n-octanoylation at serine three is essential for the train.

We designate the GH-releasing peptide ‘ghrelin’ (ghre is the Proto-Indo-European root of the phrase ‘develop’). Human ghrelin is homologous to rat ghrelin apart from two amino acids.

The incidence of ghrelin in every rat and human signifies that GH launch from the pituitary may be regulated not solely by hypothalamic GHRH, however as well as by ghrelin.

anti-Macrophage Inflammatory Protein 1 beta

YF-PA24669 50 ul
EUR 400.8
Description: Mouse polyclonal to Macrophage Inflammatory Protein 1 beta

anti-Macrophage inflammatory protein 5

YF-PA14551 100 ul
EUR 483.6
Description: Rabbit polyclonal to Macrophage inflammatory protein 5

anti-Macrophage inflammatory protein 5

YF-PA14552 100 ug
EUR 483.6
Description: Rabbit polyclonal to Macrophage inflammatory protein 5

anti-Macrophage Inflammatory Protein 4

YF-PA14553 100 ul
EUR 483.6
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 4

anti-Macrophage Inflammatory Protein 4

YF-PA14554 100 ug
EUR 483.6
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 4

anti-Macrophage Inflammatory Protein 3

YF-PA14559 50 ug
EUR 435.6
Description: Mouse polyclonal to Macrophage Inflammatory Protein 3

anti-Macrophage Inflammatory Protein 3

YF-PA14560 100 ul
EUR 483.6
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 3

anti-Macrophage Inflammatory Protein 3

YF-PA14561 100 ug
EUR 483.6
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 3

anti-Macrophage inflammatory protein 5

YF-PA24672 50 ul
EUR 400.8
Description: Mouse polyclonal to Macrophage inflammatory protein 5

anti-Macrophage Inflammatory Protein 4

YF-PA24674 50 ul
EUR 400.8
Description: Mouse polyclonal to Macrophage Inflammatory Protein 4

anti-Macrophage inflammatory protein 5

YF-PA20144 50 ug
EUR 435.6
Description: Mouse polyclonal to Macrophage inflammatory protein 5

anti-Macrophage inflammatory protein 5

YF-PA20145 100 ul
EUR 483.6
Description: Rabbit polyclonal to Macrophage inflammatory protein 5

anti-Macrophage inflammatory protein 5

YF-PA20146 100 ug
EUR 483.6
Description: Rabbit polyclonal to Macrophage inflammatory protein 5

Allograft inflammatory factor 1

AP80262 1mg
EUR 2640
  • E.coli

Allograft inflammatory factor 1

AP80348 1mg
EUR 2640
  • E.coli

Allograft inflammatory factor 1

AP80350 1mg
EUR 2640
  • E.coli

Allograft inflammatory factor 1

AP80469 1mg
EUR 2640
  • E.coli

Allograft inflammatory factor 1

AP78902 1mg
EUR 2640
  • E.coli

Anti-Macrophage inflammatory protein 5 (3D3)

YF-MA19031 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage inflammatory protein 5

Anti-Macrophage inflammatory protein 5 (1D7)

YF-MA15363 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage inflammatory protein 5

Anti-Macrophage inflammatory protein 5 (3H1)

YF-MA15365 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage inflammatory protein 5

Anti-Macrophage inflammatory protein 5 (3B7)

YF-MA15366 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage inflammatory protein 5

Anti-Macrophage inflammatory protein 5 (3B1)

YF-MA15367 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage inflammatory protein 5

Anti-Macrophage Inflammatory Protein 4 (2C6)

YF-MA15369 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage Inflammatory Protein 4

Anti-Macrophage inflammatory protein 5 (4G10)

YF-MA15364 100 ug
EUR 435.6
Description: Mouse monoclonal to Macrophage inflammatory protein 5

Inflammatory profilin Antibody

20-abx110412
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Macrophage Inflammatory Protein 1 beta/CCL4 Antibody

PB9064 100ug/vial
EUR 352.8

Anti-Macrophage Inflammatory Protein 1 beta?/CCL4 Antibody

PB9572 100ug/vial
EUR 352.8

Anti-Macrophage Inflammatory Protein 1 beta/CCL4 Antibody

PA1379 100ug/vial
EUR 352.8

Anti-CCL3/Macrophage Inflammatory Protein 1 alpha Antibody

PB9022 100ug/vial
EUR 352.8

Anti-CCL3/Macrophage Inflammatory Protein 1 alpha Antibody

PB9571 100ug/vial
EUR 352.8

ALLOGRAFT - INFLAMMATORY FACTOR-1 (AIF-1), Antibody

GWB-621C02 0.1 mg Ask for price

Anti-Macrophage Inflammatory Protein 3 beta (3E9)

YF-MA15370 200 ul
EUR 435.6
Description: Mouse monoclonal to Macrophage Inflammatory Protein 3 beta

Allograft Inflammatory Factor 1 (Aif1) Antibody

20-abx319635
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx037687-100ug 100 ug
EUR 469.2
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx037794-100ug 100 ug
EUR 469.2
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx131921
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx175326
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx175327
  • Ask for price
  • Ask for price
  • 1 mg
  • 200 ug
  • Please enquire.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx214166
  • Ask for price
  • Ask for price
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx214538
  • Ask for price
  • Ask for price
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx110941
  • Ask for price
  • Ask for price
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx109254
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx109516
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx104925
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx103213
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx103214
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx103215
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx103216
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

20-abx001285
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx025719-400ul 400 ul
EUR 627.6
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody

abx025719-80l 80 µl
EUR 343.2
  • Shipped within 5-10 working days.

Inflammatory profilin Antibody (HRP)

20-abx108966
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti- Macrophage Inflammatory Protein-1 Alpha (MIP-1 alpha) Antibody

GWB-464602 0.05 mg Ask for price
  • Anti- Macrophage Inflammatory Protein-1 Alpha (MIP-1 alpha) Antibody was previously known under catalogue number 18-251-404207 was previously known under catalogue number 18-251-404207

Allograft Inflammatory Factor 1 Protein

20-abx262211
  • Ask for price
  • Ask for price
  • Ask for price
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Inflammatory profilin Antibody (FITC)

20-abx107547
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat Allograft inflammatory factor 1 (Aif1)

1-CSB-YP001490RA
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 18.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Allograft inflammatory factor 1(Aif1) expressed in Yeast

Rat Allograft inflammatory factor 1 (Aif1)

1-CSB-EP001490RA
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 32.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Allograft inflammatory factor 1(Aif1) expressed in E.coli

Inflammatory profilin Antibody (Biotin)

20-abx106133
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Macrophage Inflammatory Protein 4/CCL18 Antibody

PB9023 100ug/vial
EUR 352.8

Allograft Inflammatory Factor 1 (Aif1) Antibody (HRP)

20-abx319636
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (HRP)

20-abx107953
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (HRP)

20-abx107954
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti- Macrophage Inflammatory Protein-1 Alpha (MIP-1a) Rat Antibody

GWB-DA3C70 0.1 mg Ask for price

Human Allograft inflammatory factor 1 (AIF1)

1-CSB-EP001490HU
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 32.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Allograft inflammatory factor 1(AIF1),partial expressed in E.coli

Mouse Allograft inflammatory factor 1 (Aif1)

1-CSB-EP001490MO
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 20.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Allograft inflammatory factor 1(Aif1) expressed in E.coli

Allograft Inflammatory Factor 1 (AIF1) Antibody (FITC)

20-abx274375
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody Pair

20-abx370492
  • Ask for price
  • Ask for price
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Allograft Inflammatory Factor 1 (Aif1) Antibody (FITC)

20-abx319637
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (FITC)

20-abx273634
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody Pair

20-abx370845
  • Ask for price
  • Ask for price
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-12 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (FITC)

20-abx106536
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (FITC)

20-abx106537
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti- Macrophage Inflammatory Protein-1 beta (MIP-1b) Mouse Antibody

GWB-B528CF 0.05 mg Ask for price

Anti- Macrophage Inflammatory Protein-1 Beta (MIP-1b) -BIOTIN Antibody

GWB-E1DEF7 0.025 mg Ask for price

Allograft Inflammatory Factor 1 Like Protein

20-abx260692
  • Ask for price
  • Ask for price
  • Ask for price
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Anti-Macrophage Inflammatory Protein-3 (MIP-3) Antibody

50174 1000ug
EUR 630

Anti-Macrophage Inflammatory Protein-3 (MIP-3) Antibody

50174-1000 1000ug
EUR 630

Anti-Macrophage Inflammatory Protein-3 (MIP-3) Antibody

50174-500 500ug
EUR 467

Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin)

20-abx274328
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Allograft Inflammatory Factor 1 (Aif1) Antibody (Biotin)

20-abx319638
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin)

20-abx272264
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin)

20-abx272826
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin)

20-abx273401
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin)

20-abx274640
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin)

20-abx105119
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin)

20-abx105120
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti- Macrophage Inflammatory Protein-1 Alpha (MIP-1a) -BIOTIN Antibody

GWB-D8EE6F 0.025 mg Ask for price

Human Macrophage Inflammatory Protein-1 beta

90218-A 2 µg
EUR 130
Description: Recombinant MIP-1 beta is a disulfide-linked homodimeric protein consisting of 70 amino acid residues, and migrates as an approximately 8 kDa protein under non-reducing and reducing conditions in SDS-PAGE. Optimized DNA sequence encoding Human MIP-1 beta chain was expressed in E. coli.

Human Macrophage Inflammatory Protein-1 beta

90218-B 10 µg
EUR 205
Description: Recombinant MIP-1 beta is a disulfide-linked homodimeric protein consisting of 70 amino acid residues, and migrates as an approximately 8 kDa protein under non-reducing and reducing conditions in SDS-PAGE. Optimized DNA sequence encoding Human MIP-1 beta chain was expressed in E. coli.

Macrophage Inflammatory Protein 1 Gamma (CCL9) Antibody

abx411718-01mg 0.1 mg
EUR 844.8
  • Shipped within 1 week.

Macrophage Inflammatory Protein 1 Beta (MIP1b) Antibody

20-abx313218
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Macrophage Inflammatory Protein 1 Beta (MIP1b) Antibody

20-abx129308
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Macrophage Inflammatory Protein 1 Beta (MIP1b) Antibody

20-abx129984
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • Ask for price
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

 

Leave A Comment