An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database.

microbiologystudents

An technique to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database.

A method to correlate the uninterpreted tandem mass spectra of peptides produced beneath low vitality (10-50 eV) collision circumstances with amino acid sequences throughout the Genpept database has been developed. On this system the protein database is searched to find out linear amino acid sequences inside a mass tolerance of ±1 u of the precursor ion molecular weight A cross-correlation function is then used to produce a measurement of similarity between the mass-to-charge ratios for the fragment ions predicted from amino acid sequences obtained from the database and the fragment ions seen throughout the tandem mass spectrum.

 

Usually, a distinction larger than 0.1 between the normalized cross-correlation options of the first- and second-ranked search outcomes signifies a worthwhile match between sequence and spectrum. Searches of species-specific protein databases with tandem mass spectra acquired from peptides obtained from the enzymatically digested complete proteins of E. coli and S.

 

cerevisiae cells allowed matching of the spectra to amino acid sequences inside proteins of these organisms. The technique described on this manuscript offers a useful methodology to interpret tandem mass spectra with acknowledged sequences in a protein database.

 

UHRF1BP1L Antibody

6461-01mg 0.1 mg
EUR 523.7
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: UHRF1BP1L Antibody: The Ubiquitin-like containing PHD and RING finger domains 1-binding protein 1-like (UHRF1BP1L) is closely related to UHRF1BP1, also known as ICBP90, a transcription and cell cycle regulator that specifically binds to the histone H3 N-terminal tail. While little is known of UHRF1BP1L, UHRF1BP1 is required for proper heterochromatin formation in mammalian cells. Furthermore, UHRF1BP1 is thought to be a pivotal target for the ERK1/2 signaling pathway to control the proliferation of Jurkat T cells, suggesting that UHRF1BP1L may also be involved in chromatin regulation and cell proliferation.

UHRF1BP1L Antibody

25349-100ul 100ul
EUR 468

UHRF1BP1L siRNA

20-abx938993
  • EUR 661.20
  • EUR 878.40
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UHRF1BP1L siRNA

20-abx938994
  • EUR 661.20
  • EUR 878.40
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UHRF1BP1L Antibody

1-CSB-PA025606LA01HU
  • EUR 380.40
  • EUR 402.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Polyclonal UHRF1BP1L Antibody

APR06720G 0.1 mg
EUR 790.8
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UHRF1BP1L . This antibody is tested and proven to work in the following applications:

UHRF1BP1L cloning plasmid

CSB-CL025606HU1-10ug 10ug
EUR 451.2
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1569
  • Sequence: atggccgggatcatcaagaaacaaatcttgaagcacctctccagatttaccaaaaatttatctcctgacaagataaatctaagtacccttaaaggagaaggtgaactgaagaatttggagttggatgaagaagtactccagaatatgttggatttgccaacatggcttgctatca
  • Show more
Description: A cloning plasmid for the UHRF1BP1L gene.

UHRF1BP1L cloning plasmid

CSB-CL025606HU2-10ug 10ug
EUR 1308
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3033
  • Sequence: ATGGCCGGGATCATCAAGAAACAAATCTTGAAGCACCTCTCCAGATTTACCAAAAATTTATCTCCTGACAAGATAAATCTAAGTACCCTTAAAGGAGAAGGTGAACTGAAGAATTTGGAGTTGGATGAAGAAGTACTCCAGAATATGTTGGATTTGCCAACATGGCTTGCTATCA
  • Show more
Description: A cloning plasmid for the UHRF1BP1L gene.

Anti-UHRF1BP1L antibody

PAab09246 100 ug
EUR 494.4

anti- UHRF1BP1L antibody

FNab09246 100µg
EUR 702
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:500-1:5000
  • Immunogen: UHRF1 binding protein 1-like
  • Uniprot ID: A0JNW5
  • Gene ID: 23074
Description: Antibody raised against UHRF1BP1L

UHRF1BP1L Polyclonal Antibody

A61674-020 20 ul
EUR 117.7

UHRF1BP1L Polyclonal Antibody

A61674-050 50 ul
EUR 302.5

UHRF1BP1L Polyclonal Antibody

A61674-100 100 ul
EUR 423.5

UHRF1BP1L Polyclonal Antibody

A61674
  • EUR 684.66
  • EUR 117.70
  • EUR 302.50
  • EUR 423.50
  • 100 µg
  • 20 ul
  • 50 ul
  • 100 ul

Mouse UHRF1BP1L shRNA Plasmid

20-abx978348
  • EUR 961.20
  • EUR 1345.20
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human UHRF1BP1L shRNA Plasmid

20-abx957978
  • EUR 961.20
  • EUR 1345.20
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UHRF1BP1L Antibody, HRP conjugated

1-CSB-PA025606LB01HU
  • EUR 380.40
  • EUR 402.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UHRF1BP1L Antibody, FITC conjugated

1-CSB-PA025606LC01HU
  • EUR 380.40
  • EUR 402.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UHRF1BP1L Antibody, Biotin conjugated

1-CSB-PA025606LD01HU
  • EUR 380.40
  • EUR 402.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

UHRF1BP1L ELISA KIT|Human

EF004066 96 Tests
EUR 826.8

Uhrf1bp1l ORF Vector (Rat) (pORF)

ORF078615 1.0 ug DNA
EUR 2496

Uhrf1bp1l ORF Vector (Mouse) (pORF)

ORF061024 1.0 ug DNA
EUR 1886.4

UHRF1BP1L ORF Vector (Human) (pORF)

ORF014885 1.0 ug DNA
EUR 424.8

UHRF1BP1L ORF Vector (Human) (pORF)

ORF011318 1.0 ug DNA
EUR 114

UHRF1BP1L Polyclonal Antibody, Biotin Conjugated

A61675-050 50 ul
EUR 302.5

UHRF1BP1L Polyclonal Antibody, Biotin Conjugated

A61675-100 100 ul
EUR 423.5

UHRF1BP1L Polyclonal Antibody, FITC Conjugated

A61676-050 50 ul
EUR 302.5

UHRF1BP1L Polyclonal Antibody, FITC Conjugated

A61676-100 100 ul
EUR 423.5

UHRF1BP1L Polyclonal Antibody, HRP Conjugated

A61677-050 50 ul
EUR 302.5

UHRF1BP1L Polyclonal Antibody, HRP Conjugated

A61677-100 100 ul
EUR 423.5

UHRF1BP1L Polyclonal Antibody, Biotin Conjugated

A61675
  • EUR 684.66
  • EUR 302.50
  • EUR 423.50
  • 100 µg
  • 50 ul
  • 100 ul

UHRF1BP1L Polyclonal Antibody, FITC Conjugated

A61676
  • EUR 684.66
  • EUR 302.50
  • EUR 423.50
  • 100 µg
  • 50 ul
  • 100 ul

UHRF1BP1L Polyclonal Antibody, HRP Conjugated

A61677
  • EUR 684.66
  • EUR 302.50
  • EUR 423.50
  • 100 µg
  • 50 ul
  • 100 ul

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-48T 48T
EUR 632.4
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-96T 96T
EUR 825.6
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-48T 48T
EUR 477.6
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-96T 96T
EUR 613.2
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-48T 48T
EUR 540
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-96T 96T
EUR 698.4
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-48T 48T
EUR 560.4
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-96T 96T
EUR 726
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

RD-C-Peptide-c-48Tests 48 Tests
EUR 639.6

Canine C-Peptide ELISA Kit

RD-C-Peptide-c-96Tests 96 Tests
EUR 888

Human C-Peptide ELISA Kit

RD-C-Peptide-Hu-48Tests 48 Tests
EUR 464.4

Human C-Peptide ELISA Kit

RD-C-Peptide-Hu-96Tests 96 Tests
EUR 638.4

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-48Tests 48 Tests
EUR 535.2

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-96Tests 96 Tests
EUR 738

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-48Tests 48 Tests
EUR 558

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-96Tests 96 Tests
EUR 771.6

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-48Tests 48 Tests
EUR 668.4

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-96Tests 96 Tests
EUR 928.8

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-48Tests 48 Tests
EUR 484.8

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-96Tests 96 Tests
EUR 667.2

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-48Tests 48 Tests
EUR 558

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-96Tests 96 Tests
EUR 771.6

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-48Tests 48 Tests
EUR 583.2

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-96Tests 96 Tests
EUR 806.4

Uhrf1bp1l sgRNA CRISPR Lentivector set (Rat)

K6609801 3 x 1.0 ug
EUR 406.8

Uhrf1bp1l sgRNA CRISPR Lentivector set (Mouse)

K4538801 3 x 1.0 ug
EUR 406.8

UHRF1BP1L sgRNA CRISPR Lentivector set (Human)

K2586801 3 x 1.0 ug
EUR 406.8

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody

abx028888-400ul 400 ul
EUR 627.6
  • Shipped within 5-10 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody

abx028888-80l 80 µl
EUR 343.2
  • Shipped within 5-10 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody

20-abx305894
  • EUR 493.20
  • EUR 2214.00
  • EUR 718.80
  • EUR 218.40
  • EUR 360.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody

abx239246-100ug 100 ug
EUR 661.2
  • Shipped within 5-12 working days.

Uhrf1bp1l sgRNA CRISPR Lentivector (Rat) (Target 1)

K6609802 1.0 ug DNA
EUR 184.8

Uhrf1bp1l sgRNA CRISPR Lentivector (Rat) (Target 2)

K6609803 1.0 ug DNA
EUR 184.8

Uhrf1bp1l sgRNA CRISPR Lentivector (Rat) (Target 3)

K6609804 1.0 ug DNA
EUR 184.8

Uhrf1bp1l sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4538802 1.0 ug DNA
EUR 184.8

Uhrf1bp1l sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4538803 1.0 ug DNA
EUR 184.8

Uhrf1bp1l sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4538804 1.0 ug DNA
EUR 184.8

UHRF1BP1L sgRNA CRISPR Lentivector (Human) (Target 1)

K2586802 1.0 ug DNA
EUR 184.8

UHRF1BP1L sgRNA CRISPR Lentivector (Human) (Target 2)

K2586803 1.0 ug DNA
EUR 184.8

UHRF1BP1L sgRNA CRISPR Lentivector (Human) (Target 3)

K2586804 1.0 ug DNA
EUR 184.8

UHRF1BP1L Protein Vector (Human) (pPB-C-His)

PV045269 500 ng
EUR 394.8

UHRF1BP1L Protein Vector (Human) (pPB-N-His)

PV045270 500 ng
EUR 394.8

UHRF1BP1L Protein Vector (Human) (pPM-C-HA)

PV045271 500 ng
EUR 394.8

UHRF1BP1L Protein Vector (Human) (pPM-C-His)

PV045272 500 ng
EUR 394.8

UHRF1BP1L Protein Vector (Human) (pPB-C-His)

PV059537 500 ng
EUR 577.2

UHRF1BP1L Protein Vector (Human) (pPB-N-His)

PV059538 500 ng
EUR 577.2

UHRF1BP1L Protein Vector (Human) (pPM-C-HA)

PV059539 500 ng
EUR 577.2

UHRF1BP1L Protein Vector (Human) (pPM-C-His)

PV059540 500 ng
EUR 577.2

UHRF1BP1L 3'UTR GFP Stable Cell Line

TU077815 1.0 ml
EUR 1672.8

Uhrf1bp1l 3'UTR GFP Stable Cell Line

TU272852 1.0 ml Ask for price

Uhrf1bp1l 3'UTR GFP Stable Cell Line

TU171570 1.0 ml Ask for price

Uhrf1bp1l 3'UTR Luciferase Stable Cell Line

TU222852 1.0 ml Ask for price

Uhrf1bp1l 3'UTR Luciferase Stable Cell Line

TU121570 1.0 ml Ask for price

UHRF1BP1L Protein Vector (Rat) (pPB-C-His)

PV314458 500 ng
EUR 2985.6

 

CHARMM: the biomolecular simulation program.

CHARMM (Chemistry at HARvard Molecular Mechanics) is a extraordinarily versatile and broadly used molecular simulation program.

It has been developed over the previous three a few years with a primary give consideration to molecules of natural curiosity, along with proteins, peptides, lipids, nucleic acids, carbohydrates, and small molecule ligands, as they occur in reply, crystals, and membrane environments.

For the look at of such methods, this method offers a giant suite of computational devices that embrace fairly just a few conformational and path sampling methods, free vitality estimators, molecular minimization, dynamics, and analysis strategies, and model-building capabilities.

The CHARMM program is related to points involving a a lot wider class of many-particle methods.

Calculations with CHARMM could also be carried out using numerous fully totally different vitality options and fashions, from blended quantum mechanical-molecular mechanical stress fields, to all-atom classical potential vitality options with particular solvent and quite a few boundary circumstances, to implicit solvent and membrane fashions.

This method has been ported to fairly just a few platforms in every serial and parallel architectures. This textual content offers an overview of this method as a result of it exists within the current day with an emphasis on developments as a result of the publication of the distinctive CHARMM article in 1983.

 

Ghrelin is a growth-hormone-releasing acylated peptide from stomach.

 

Small synthetic molecules often known as growth-hormone secretagogues (GHSs) stimulate the discharge of improvement hormone (GH) from the pituitary. They act by means of GHS-R, a G-protein-coupled receptor for which the ligand is unknown.

Present cloning of GHS-R strongly implies that an endogenous ligand for the receptor does exist and that there is a mechanism for regulating GH launch that is distinct from its regulation by hypothalamic growth-hormone-releasing hormone (GHRH).

 

We now report the purification and identification in rat stomach of an endogenous ligand explicit for GHS-R.

The purified ligand is a peptide of 28 amino acids, by which the serine three residue is n-octanoylated. The acylated peptide notably releases GH every in vivo and in vitro, and O-n-octanoylation at serine three is essential for the train.

We designate the GH-releasing peptide ‘ghrelin’ (ghre is the Proto-Indo-European root of the phrase ‘develop’). Human ghrelin is homologous to rat ghrelin apart from two amino acids.

The incidence of ghrelin in every rat and human signifies that GH launch from the pituitary may be regulated not solely by hypothalamic GHRH, however as well as by ghrelin.

Goat Anti-Mouse IgG Fc, 10MG

A008-10MG 10MG
EUR 321.6

Goat Anti-Rabbit IgG Fc, 10MG

A009-10MG 10MG
EUR 321.6

Anti-Inflammatory Peptide 1

5-00709 4 x 5mg Ask for price

Anti-Inflammatory Peptide 1

A1008-10 10 mg
EUR 199.2
Description: Anti-Inflammatory Peptide 1 (C45H82N12O14S2), with the sequence H-Met-Gln-Met-Lys-Lys-Val-Leu-Asp-Ser-OH, belongs to the group of synthetic oligopeptides corresponding to a region of high amino-acid sequence similarity between uteroglobin and lipocortin I

Anti-Inflammatory Peptide 1

A1008-25 25 mg
EUR 254.4
Description: Anti-Inflammatory Peptide 1 (C45H82N12O14S2), with the sequence H-Met-Gln-Met-Lys-Lys-Val-Leu-Asp-Ser-OH, belongs to the group of synthetic oligopeptides corresponding to a region of high amino-acid sequence similarity between uteroglobin and lipocortin I

Anti-Inflammatory Peptide 1

A1008-5 5 mg
EUR 142.8
Description: Anti-Inflammatory Peptide 1 (C45H82N12O14S2), with the sequence H-Met-Gln-Met-Lys-Lys-Val-Leu-Asp-Ser-OH, belongs to the group of synthetic oligopeptides corresponding to a region of high amino-acid sequence similarity between uteroglobin and lipocortin I

Anti-Inflammatory Peptide 1

H-9435.0005 5.0mg
EUR 327.6
Description: Sum Formula: C45H82N12O14S2; CAS# [118850-71-8]

Anti-Inflammatory Peptide 1

H-9435.0025 25.0mg
EUR 1197.6
Description: Sum Formula: C45H82N12O14S2; CAS# [118850-71-8]

Doxorubicin HCl, 10mg

R2531-10mg
EUR 236.4

Donkey Anti-Sheep IgG (H&L), 10MG

A010-10MG 10MG
EUR 321.6

Recombinant other protein 1, Untagged, E.coli-10mg

QP13162-10mg 10mg
EUR 241.2

Anti-Inflammatory Peptide 2

5-00710 4 x 5mg Ask for price

Anti-Inflammatory Peptide 3

5-00711 4 x 5mg Ask for price

Anti-Inflammatory Peptide 2

H-9440.0005 5.0mg
EUR 327.6
Description: Sum Formula: C46H77N13O15S; CAS# [118850-72-9]

Anti-Inflammatory Peptide 2

H-9440.0025 25.0mg
EUR 1197.6
Description: Sum Formula: C46H77N13O15S; CAS# [118850-72-9]

Recombinant other Alarelin Protein, Untagged, -10mg

QP10997-10mg 10mg
EUR 241.2

Recombinant other protein 1, Untagged, E.coli-10mg

QP10853-EC-10mg 10mg
EUR 186

Recombinant Human GH1/ Growth hormone 1 Protein, Untagged, E.coli-10mg

QP5354-10mg 10mg
EUR 1491.6

Recombinant other Avidin Biotin Protein, Untagged, -10mg

QP10526-10mg 10mg
EUR 241.2

Recombinant Human CTRB1 Protein, Untagged, E.coli-10mg

QP10565-10mg 10mg
EUR 241.2

Recombinant Human Insulin Protein, Untagged, E.coli-10mg

QP10732-10mg 10mg
EUR 241.2

Recombinant other Lysostaphin Protein, Untagged, E.coli-10mg

QP10778-10mg 10mg
EUR 501.6

Recombinant Multi Species ACTH Protein, Untagged, -10mg

QP10950-10mg 10mg
EUR 241.2

Recombinant other Atosiban Protein, Untagged, E.coli-10mg

QP11102-10mg 10mg
EUR 186

Recombinant E.coli LACTB Protein, Untagged, E.coli-10mg

QP12522-10mg 10mg
EUR 1154.4

Recombinant other Lanreotide Protein, Untagged, E.coli-10mg

QP12536-10mg 10mg
EUR 675.6

Recombinant Human LHRH Protein, Untagged, E.coli-10mg

QP12569-10mg 10mg
EUR 186

Recombinant other SPA Protein, His, E.coli-10mg

QP13566-10mg 10mg
EUR 186

Recombinant other SST Protein, Untagged, E.coli-10mg

QP13598-10mg 10mg
EUR 241.2

Recombinant Rabbit TNC Protein, Untagged, Rabbit-10mg

QP13765-10mg 10mg
EUR 1273.2

Recombinant other Cetrorelix Protein, Untagged, E.coli-10mg

QP11394-10mg 10mg
EUR 1034.4

Recombinant Human EDN3 Protein, Untagged, E.coli-10mg

QP11747-10mg 10mg
EUR 2818.8

Recombinant other Exenatide Protein, Untagged, E.coli-10mg

QP11816-10mg 10mg
EUR 1154.4

Recombinant Human Leptin Protein, Untagged, E.coli-10mg

QP5350-10mg 10mg
EUR 610.8

Recombinant Mouse Leptin Protein, Untagged, E.coli-10mg

QP5429-10mg 10mg
EUR 1154.4

Recombinant Rat Leptin Protein, Untagged, E.coli-10mg

QP5507-10mg 10mg
EUR 1099.2

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 336

Recombinant other hCG Protein, Untagged, Native Protein-10mg

QP10664-10mg 10mg
EUR 294

Recombinant other Lipase A Protein, Untagged, E.coli-10mg

QP10772-10mg 10mg
EUR 186

Recombinant Human MG Protein, Untagged, Native Protein-10mg

QP10785-10mg 10mg
EUR 588

Recombinant Bovine Trypsin Protein, Untagged, Native Protein-10mg

QP10896-10mg 10mg
EUR 241.2

Recombinant Human UTI Protein, Untagged, Native Protein-10mg

QP10909-10mg 10mg
EUR 250.8

Recombinant Human A2M Protein, Untagged, Native Protein-10mg

QP10922-10mg 10mg
EUR 1948.8

Recombinant Human APOB Protein, Untagged, Native Protein-10mg

QP11047-10mg 10mg
EUR 5463.6

Recombinant Human B2M Protein, Untagged, Native Protein-10mg

QP11117-10mg 10mg
EUR 1698

Recombinant Human LDL Protein, Untagged, Native Protein-10mg

QP12550-10mg 10mg
EUR 195.6

Recombinant Human LTF Protein, Untagged, Native Protein-10mg

QP12595-10mg 10mg
EUR 5821.2

Recombinant Human LTF Holo Protein, Untagged, Rice-10mg

QP12596-10mg 10mg
EUR 186

Recombinant Human Myoglobin Protein, Untagged, Native Protein-10mg

QP12776-10mg 10mg
EUR 2470.8

Recombinant other Protein-L Protein, Untagged, E.coli-10mg

QP13168-10mg 10mg
EUR 241.2

Recombinant other SPA 33.4kDa Protein, Untagged, E.coli-10mg

QP13567-10mg 10mg
EUR 186

Recombinant other SPA Long Protein, Untagged, E.coli-10mg

QP13568-10mg 10mg
EUR 186

Recombinant other SPA-Cys Protein, Untagged, E.coli-10mg

QP13569-10mg 10mg
EUR 186

Recombinant other Streptavidin Protein, Untagged, Native Protein-10mg

QP13625-10mg 10mg
EUR 241.2

Recombinant Multi Species Trp Protein, Untagged, E.coli-10mg

QP13821-10mg 10mg
EUR 294

Recombinant Human C1q Protein, Untagged, Native Protein-10mg

QP11228-10mg 10mg
EUR 5463.6

Recombinant Human C3c Protein, Untagged, Native Protein-10mg

QP11238-10mg 10mg
EUR 1393.2

Recombinant Human C4c Protein, Untagged, Native Protein-10mg

QP11240-10mg 10mg
EUR 4267.2

Recombinant Human CKM Protein, Untagged, Native Protein-10mg

QP11436-10mg 10mg
EUR 5767.2

Recombinant Human CRP Protein, Untagged, Native Protein-10mg

QP11511-10mg 10mg
EUR 1099.2

Recombinant Human Ferritin Protein, Untagged, Native Protein-10mg

QP11867-10mg 10mg
EUR 2589.6

Recombinant Bovine Fibronectin Protein, Untagged, Native Protein-10mg

QP11880-10mg 10mg
EUR 1220.4

Recombinant Human Fibronectin Protein, Untagged, Native Protein-10mg

QP11881-10mg 10mg
EUR 1220.4

Recombinant Human Haptoglobin Protein, Untagged, Native Protein-10mg

QP12103-10mg 10mg
EUR 2350.8

Recombinant Human HbA1c Protein, Untagged, Native Protein-10mg

QP12117-10mg 10mg
EUR 2710.8

Recombinant Human HDL Protein, Untagged, Native Protein-10mg

QP12211-10mg 10mg
EUR 241.2

Recombinant other HSA Protein, Untagged, Pichia Pastoris-10mg

QP12314-10mg 10mg
EUR 186

Recombinant other HSA Recombinant Protein, Untagged, Rice-10mg

QP12317-10mg 10mg
EUR 195.6

Recombinant other Protein-A/G Protein, His, E.coli-10mg

QP13163-10mg 10mg
EUR 241.2

Recombinant other Protein-G His Protein, His, E.coli-10mg

QP13167-10mg 10mg
EUR 381.6

Recombinant other Protein-L Cys Protein, Untagged, E.coli-10mg

QP13169-10mg 10mg
EUR 241.2

Recombinant other SPA-Cys His Protein, His, E.coli-10mg

QP13570-10mg 10mg
EUR 186

Recombinant other SPA-Cys Long Protein, Untagged, E.coli-10mg

QP13571-10mg 10mg
EUR 186

Recombinant Human Collagen-III Protein, Untagged, Pichia Pastoris-10mg

QP11479-10mg 10mg
EUR 337.2

Recombinant other Cys-Protein-G Protein, Untagged, E.coli-10mg

QP11587-10mg 10mg
EUR 381.6

Recombinant other Cys-Protein-L Protein, Untagged, E.coli-10mg

QP11588-10mg 10mg
EUR 241.2

Recombinant other HSA Lipid free Protein, Untagged, Rice-10mg

QP12316-10mg 10mg
EUR 195.6

Anti-Kentsin Peptide

20-abx265748
  • EUR 393.60
  • EUR 594.00
  • EUR 326.40
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Anti-Flt1 Peptide

20-abx265801
  • EUR 393.60
  • EUR 594.00
  • EUR 326.40
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Recombinant other Protein Cys-A/G Protein, Untagged, E.coli-10mg

QP13161-10mg 10mg
EUR 241.2

Recombinant other Protein-A/G Cys Protein, Untagged, E.coli-10mg

QP13164-10mg 10mg
EUR 241.2

Recombinant other Protein-A/G/L Protein, Untagged, E.coli-10mg

QP13165-10mg 10mg
EUR 392.4

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 418.8

Recombinant other Protein-A/G/L-Cys Protein, Untagged, E.coli-10mg

QP13166-10mg 10mg
EUR 392.4

Recombinant other Cys-Protein-A/G/L Protein, Untagged, E.coli-10mg

QP11586-10mg 10mg
EUR 392.4

Hemokinin 1 Peptide

20-abx265072
  • EUR 594.00
  • EUR 978.00
  • EUR 427.20
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Hemokinin 1 Peptide

20-abx265383
  • EUR 594.00
  • EUR 978.00
  • EUR 427.20
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Achatin-1 Peptide

20-abx265822
  • EUR 410.40
  • EUR 627.60
  • EUR 326.40
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Endomorphin-1 Peptide

20-abx265857
  • EUR 427.20
  • EUR 644.40
  • EUR 343.20
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

AF-1 Peptide

20-abx265891
  • EUR 427.20
  • EUR 644.40
  • EUR 343.20
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

WWamide-1 Peptide

20-abx265990
  • EUR 460.80
  • EUR 710.40
  • EUR 360.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

S6-1 Peptide

20-abx266162
  • EUR 526.80
  • EUR 861.60
  • EUR 393.60
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

KL-1 Peptide

20-abx266293
  • EUR 594.00
  • EUR 978.00
  • EUR 427.20
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Alloferon 1 Peptide

20-abx266358
  • EUR 627.60
  • EUR 1045.20
  • EUR 460.80
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

 

Leave A Comment