An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database.

microbiologystudents

An technique to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database.

A method to correlate the uninterpreted tandem mass spectra of peptides produced beneath low vitality (10-50 eV) collision circumstances with amino acid sequences throughout the Genpept database has been developed. On this system the protein database is searched to find out linear amino acid sequences inside a mass tolerance of ±1 u of the precursor ion molecular weight A cross-correlation function is then used to produce a measurement of similarity between the mass-to-charge ratios for the fragment ions predicted from amino acid sequences obtained from the database and the fragment ions seen throughout the tandem mass spectrum.

 

Usually, a distinction larger than 0.1 between the normalized cross-correlation options of the first- and second-ranked search outcomes signifies a worthwhile match between sequence and spectrum. Searches of species-specific protein databases with tandem mass spectra acquired from peptides obtained from the enzymatically digested complete proteins of E. coli and S.

 

cerevisiae cells allowed matching of the spectra to amino acid sequences inside proteins of these organisms. The technique described on this manuscript offers a useful methodology to interpret tandem mass spectra with acknowledged sequences in a protein database.

 

UHRF1BP1L Antibody

25349-100ul 100ul
EUR 390.00

UHRF1BP1L Antibody

1-CSB-PA025606LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is Unconjugated. Tested in the following application: ELISA

UHRF1BP1L Polyclonal Antibody

A61674 100 µg
EUR 570.55
Description: kits suitable for this type of research

UHRF1BP1L cloning plasmid

CSB-CL025606HU1-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1569
  • Sequence: atggccgggatcatcaagaaacaaatcttgaagcacctctccagatttaccaaaaatttatctcctgacaagataaatctaagtacccttaaaggagaaggtgaactgaagaatttggagttggatgaagaagtactccagaatatgttggatttgccaacatggcttgctatca
  • Show more
Description: A cloning plasmid for the UHRF1BP1L gene.

UHRF1BP1L cloning plasmid

CSB-CL025606HU2-10ug 10ug
EUR 1090.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3033
  • Sequence: ATGGCCGGGATCATCAAGAAACAAATCTTGAAGCACCTCTCCAGATTTACCAAAAATTTATCTCCTGACAAGATAAATCTAAGTACCCTTAAAGGAGAAGGTGAACTGAAGAATTTGGAGTTGGATGAAGAAGTACTCCAGAATATGTTGGATTTGCCAACATGGCTTGCTATCA
  • Show more
Description: A cloning plasmid for the UHRF1BP1L gene.

Polyclonal UHRF1BP1L Antibody

APR06720G 0.1 mg
EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UHRF1BP1L . This antibody is tested and proven to work in the following applications:

Anti-UHRF1BP1L antibody

PAab09246 100 ug
EUR 412.00

anti- UHRF1BP1L antibody

FNab09246 100µg
EUR 585.00
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:500-1:5000
  • Immunogen: UHRF1 binding protein 1-like
  • Uniprot ID: A0JNW5
  • Gene ID: 23074
Description: Antibody raised against UHRF1BP1L

Human UHRF1BP1L shRNA Plasmid

20-abx957978
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse UHRF1BP1L shRNA Plasmid

20-abx978348
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UHRF1BP1L Antibody, HRP conjugated

1-CSB-PA025606LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UHRF1BP1L Antibody, FITC conjugated

1-CSB-PA025606LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UHRF1BP1L Antibody, Biotin conjugated

1-CSB-PA025606LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

UHRF1BP1L ELISA KIT|Human

EF004066 96 Tests
EUR 689.00

UHRF1BP1L Polyclonal Antibody, Biotin Conjugated

A61675 100 µg
EUR 570.55
Description: fast delivery possible

UHRF1BP1L Polyclonal Antibody, FITC Conjugated

A61676 100 µg
EUR 570.55
Description: reagents widely cited

UHRF1BP1L Polyclonal Antibody, HRP Conjugated

A61677 100 µg
EUR 570.55
Description: Ask the seller for details

UHRF1BP1L ORF Vector (Human) (pORF)

ORF014885 1.0 ug DNA
EUR 354.00

Uhrf1bp1l ORF Vector (Rat) (pORF)

ORF078615 1.0 ug DNA
EUR 2080.00

Uhrf1bp1l ORF Vector (Mouse) (pORF)

ORF061024 1.0 ug DNA
EUR 1572.00

UHRF1BP1L ORF Vector (Human) (pORF)

ORF011318 1.0 ug DNA
EUR 95.00

Canine C-Peptide ELISA Kit

DL-C-Peptide-c-192 1 kit of 192 tests
EUR 1180.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Canine C-Peptide

Canine C-Peptide ELISA Kit

DL-C-Peptide-c-48 1 kit of 48 tests
EUR 492.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Canine C-Peptide

Canine C-Peptide ELISA Kit

DL-C-Peptide-c-96 1 kit of 96 tests
EUR 660.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Canine C-Peptide

Human C-Peptide ELISA Kit

DL-C-Peptide-Hu-192 1 kit of 192 tests
EUR 842.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Human C-Peptide

Human C-Peptide ELISA Kit

DL-C-Peptide-Hu-48 1 kit of 48 tests
EUR 374.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Human C-Peptide

Human C-Peptide ELISA Kit

DL-C-Peptide-Hu-96 1 kit of 96 tests
EUR 491.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Human C-Peptide

Mouse C-Peptide ELISA Kit

DL-C-Peptide-Mu-192 1 kit of 192 tests
EUR 978.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Mouse C-Peptide

Mouse C-Peptide ELISA Kit

DL-C-Peptide-Mu-48 1 kit of 48 tests
EUR 421.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Mouse C-Peptide

Mouse C-Peptide ELISA Kit

DL-C-Peptide-Mu-96 1 kit of 96 tests
EUR 559.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Mouse C-Peptide

Rat C-Peptide ELISA Kit

DL-C-Peptide-Ra-192 1 kit of 192 tests
EUR 1023.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Rat C-Peptide

Rat C-Peptide ELISA Kit

DL-C-Peptide-Ra-48 1 kit of 48 tests
EUR 437.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Rat C-Peptide

Rat C-Peptide ELISA Kit

DL-C-Peptide-Ra-96 1 kit of 96 tests
EUR 581.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Rat C-Peptide

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-48T 48T
EUR 527.00
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-96T 96T
EUR 688.00
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-48T 48T
EUR 398.00
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-96T 96T
EUR 511.00
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-48T 48T
EUR 450.00
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-96T 96T
EUR 582.00
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-48T 48T
EUR 467.00
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-96T 96T
EUR 605.00
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

RD-C-Peptide-c-48Tests 48 Tests
EUR 533.00

Canine C-Peptide ELISA Kit

RD-C-Peptide-c-96Tests 96 Tests
EUR 740.00

Human C-Peptide ELISA Kit

RD-C-Peptide-Hu-48Tests 48 Tests
EUR 387.00

Human C-Peptide ELISA Kit

RD-C-Peptide-Hu-96Tests 96 Tests
EUR 532.00

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-48Tests 48 Tests
EUR 446.00

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-96Tests 96 Tests
EUR 615.00

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-48Tests 48 Tests
EUR 465.00

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-96Tests 96 Tests
EUR 643.00

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-48Tests 48 Tests
EUR 557.00

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-96Tests 96 Tests
EUR 774.00

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-48Tests 48 Tests
EUR 404.00

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-96Tests 96 Tests
EUR 556.00

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-48Tests 48 Tests
EUR 465.00

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-96Tests 96 Tests
EUR 643.00

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-48Tests 48 Tests
EUR 486.00

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-96Tests 96 Tests
EUR 672.00

Uhrf1bp1l sgRNA CRISPR Lentivector set (Mouse)

K4538801 3 x 1.0 ug
EUR 339.00

Uhrf1bp1l sgRNA CRISPR Lentivector set (Rat)

K6609801 3 x 1.0 ug
EUR 339.00

UHRF1BP1L sgRNA CRISPR Lentivector set (Human)

K2586801 3 x 1.0 ug
EUR 339.00

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody

20-abx305894
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody

abx239246-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody

abx028888-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody

abx028888-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

UHRF1BP1L Protein Vector (Human) (pPB-C-His)

PV059537 500 ng
EUR 481.00

UHRF1BP1L Protein Vector (Human) (pPB-N-His)

PV059538 500 ng
EUR 481.00

UHRF1BP1L Protein Vector (Human) (pPM-C-HA)

PV059539 500 ng
EUR 481.00

UHRF1BP1L Protein Vector (Human) (pPM-C-His)

PV059540 500 ng
EUR 481.00

UHRF1BP1L Protein Vector (Human) (pPB-C-His)

PV045269 500 ng
EUR 329.00

UHRF1BP1L Protein Vector (Human) (pPB-N-His)

PV045270 500 ng
EUR 329.00

UHRF1BP1L Protein Vector (Human) (pPM-C-HA)

PV045271 500 ng
EUR 329.00

UHRF1BP1L Protein Vector (Human) (pPM-C-His)

PV045272 500 ng
EUR 329.00

Uhrf1bp1l sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4538802 1.0 ug DNA
EUR 154.00

Uhrf1bp1l sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4538803 1.0 ug DNA
EUR 154.00

Uhrf1bp1l sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4538804 1.0 ug DNA
EUR 154.00

Uhrf1bp1l sgRNA CRISPR Lentivector (Rat) (Target 1)

K6609802 1.0 ug DNA
EUR 154.00

Uhrf1bp1l sgRNA CRISPR Lentivector (Rat) (Target 2)

K6609803 1.0 ug DNA
EUR 154.00

Uhrf1bp1l sgRNA CRISPR Lentivector (Rat) (Target 3)

K6609804 1.0 ug DNA
EUR 154.00

UHRF1BP1L sgRNA CRISPR Lentivector (Human) (Target 1)

K2586802 1.0 ug DNA
EUR 154.00

UHRF1BP1L sgRNA CRISPR Lentivector (Human) (Target 2)

K2586803 1.0 ug DNA
EUR 154.00

UHRF1BP1L sgRNA CRISPR Lentivector (Human) (Target 3)

K2586804 1.0 ug DNA
EUR 154.00

UHRF1BP1L 3'UTR Luciferase Stable Cell Line

TU027815 1.0 ml
EUR 1394.00

UHRF1BP1L Protein Vector (Rat) (pPB-C-His)

PV314458 500 ng
EUR 2488.00

UHRF1BP1L Protein Vector (Rat) (pPB-N-His)

PV314459 500 ng
EUR 2488.00

UHRF1BP1L Protein Vector (Rat) (pPM-C-HA)

PV314460 500 ng
EUR 2488.00

UHRF1BP1L Protein Vector (Rat) (pPM-C-His)

PV314461 500 ng
EUR 2488.00

UHRF1BP1L Protein Vector (Mouse) (pPB-C-His)

PV244094 500 ng
EUR 2472.00

 

CHARMM: the biomolecular simulation program.

CHARMM (Chemistry at HARvard Molecular Mechanics) is a extraordinarily versatile and broadly used molecular simulation program.

It has been developed over the previous three a few years with a primary give consideration to molecules of natural curiosity, along with proteins, peptides, lipids, nucleic acids, carbohydrates, and small molecule ligands, as they occur in reply, crystals, and membrane environments.

For the look at of such methods, this method offers a giant suite of computational devices that embrace fairly just a few conformational and path sampling methods, free vitality estimators, molecular minimization, dynamics, and analysis strategies, and model-building capabilities.

The CHARMM program is related to points involving a a lot wider class of many-particle methods.

Calculations with CHARMM could also be carried out using numerous fully totally different vitality options and fashions, from blended quantum mechanical-molecular mechanical stress fields, to all-atom classical potential vitality options with particular solvent and quite a few boundary circumstances, to implicit solvent and membrane fashions.

This method has been ported to fairly just a few platforms in every serial and parallel architectures. This textual content offers an overview of this method as a result of it exists within the current day with an emphasis on developments as a result of the publication of the distinctive CHARMM article in 1983.

 

Ghrelin is a growth-hormone-releasing acylated peptide from stomach.

 

Small synthetic molecules often known as growth-hormone secretagogues (GHSs) stimulate the discharge of improvement hormone (GH) from the pituitary. They act by means of GHS-R, a G-protein-coupled receptor for which the ligand is unknown.

Present cloning of GHS-R strongly implies that an endogenous ligand for the receptor does exist and that there is a mechanism for regulating GH launch that is distinct from its regulation by hypothalamic growth-hormone-releasing hormone (GHRH).

 

We now report the purification and identification in rat stomach of an endogenous ligand explicit for GHS-R.

The purified ligand is a peptide of 28 amino acids, by which the serine three residue is n-octanoylated. The acylated peptide notably releases GH every in vivo and in vitro, and O-n-octanoylation at serine three is essential for the train.

We designate the GH-releasing peptide ‘ghrelin’ (ghre is the Proto-Indo-European root of the phrase ‘develop’). Human ghrelin is homologous to rat ghrelin apart from two amino acids.

The incidence of ghrelin in every rat and human signifies that GH launch from the pituitary may be regulated not solely by hypothalamic GHRH, however as well as by ghrelin.

Donkey Anti-Sheep IgG (H&L), 10MG

A010-10MG 10MG
EUR 268.00

Anti-Inflammatory Peptide 1

20-abx266089
  • EUR 411.00
  • EUR 662.00
  • EUR 314.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Anti-Inflammatory Peptide 1

A1008-10 10 mg
EUR 166.00
Description: Anti-Inflammatory Peptide 1 (C45H82N12O14S2), with the sequence H-Met-Gln-Met-Lys-Lys-Val-Leu-Asp-Ser-OH, belongs to the group of synthetic oligopeptides corresponding to a region of high amino-acid sequence similarity between uteroglobin and lipocortin I

Anti-Inflammatory Peptide 1

A1008-25 25 mg
EUR 212.00
Description: Anti-Inflammatory Peptide 1 (C45H82N12O14S2), with the sequence H-Met-Gln-Met-Lys-Lys-Val-Leu-Asp-Ser-OH, belongs to the group of synthetic oligopeptides corresponding to a region of high amino-acid sequence similarity between uteroglobin and lipocortin I

Anti-Inflammatory Peptide 1

A1008-5 5 mg
EUR 119.00
Description: Anti-Inflammatory Peptide 1 (C45H82N12O14S2), with the sequence H-Met-Gln-Met-Lys-Lys-Val-Leu-Asp-Ser-OH, belongs to the group of synthetic oligopeptides corresponding to a region of high amino-acid sequence similarity between uteroglobin and lipocortin I

Anti-Inflammatory Peptide 1

5-00709 4 x 5mg Ask for price

Anti-Inflammatory Peptide 1

H-9435.0005 5.0mg
EUR 273.00
Description: Sum Formula: C45H82N12O14S2; CAS# [118850-71-8]

Anti-Inflammatory Peptide 1

H-9435.0025 25.0mg
EUR 998.00
Description: Sum Formula: C45H82N12O14S2; CAS# [118850-71-8]

Recombinant other protein 1, Untagged, E.coli-10mg

QP13162-10mg 10mg
EUR 201.00

Recombinant other Alarelin Protein, Untagged, -10mg

QP10997-10mg 10mg
EUR 201.00

Recombinant other protein 1, Untagged, E.coli-10mg

QP10853-EC-10mg 10mg
EUR 155.00

Recombinant Human GH1/ Growth hormone 1 Protein, Untagged, E.coli-10mg

QP5354-10mg 10mg
EUR 1243.00

Recombinant other Atosiban Protein, Untagged, E.coli-10mg

QP11102-10mg 10mg
EUR 155.00

Recombinant other Cetrorelix Protein, Untagged, E.coli-10mg

QP11394-10mg 10mg
EUR 862.00

Recombinant Human EDN3 Protein, Untagged, E.coli-10mg

QP11747-10mg 10mg
EUR 2349.00

Recombinant other Exenatide Protein, Untagged, E.coli-10mg

QP11816-10mg 10mg
EUR 962.00

Recombinant E.coli LACTB Protein, Untagged, E.coli-10mg

QP12522-10mg 10mg
EUR 962.00

Recombinant other Lanreotide Protein, Untagged, E.coli-10mg

QP12536-10mg 10mg
EUR 563.00

Recombinant Human LHRH Protein, Untagged, E.coli-10mg

QP12569-10mg 10mg
EUR 155.00

Recombinant other SPA Protein, His, E.coli-10mg

QP13566-10mg 10mg
EUR 155.00

Recombinant other SST Protein, Untagged, E.coli-10mg

QP13598-10mg 10mg
EUR 201.00

Recombinant Rabbit TNC Protein, Untagged, Rabbit-10mg

QP13765-10mg 10mg
EUR 1061.00

Recombinant Human Leptin Protein, Untagged, E.coli-10mg

QP5350-10mg 10mg
EUR 509.00

Recombinant Mouse Leptin Protein, Untagged, E.coli-10mg

QP5429-10mg 10mg
EUR 962.00

Recombinant Rat Leptin Protein, Untagged, E.coli-10mg

QP5507-10mg 10mg
EUR 916.00

Recombinant other Avidin Biotin Protein, Untagged, -10mg

QP10526-10mg 10mg
EUR 201.00

Recombinant Human CTRB1 Protein, Untagged, E.coli-10mg

QP10565-10mg 10mg
EUR 201.00

Recombinant Human Insulin Protein, Untagged, E.coli-10mg

QP10732-10mg 10mg
EUR 201.00

Recombinant other Lysostaphin Protein, Untagged, E.coli-10mg

QP10778-10mg 10mg
EUR 418.00

Recombinant Multi Species ACTH Protein, Untagged, -10mg

QP10950-10mg 10mg
EUR 201.00

Anti-Inflammatory Peptide 3

20-abx266075
  • EUR 411.00
  • EUR 662.00
  • EUR 314.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Anti-Inflammatory Peptide 2

20-abx266098
  • EUR 411.00
  • EUR 662.00
  • EUR 314.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Anti-Inflammatory Peptide 2

5-00710 4 x 5mg Ask for price

Anti-Inflammatory Peptide 3

5-00711 4 x 5mg Ask for price

Anti-Inflammatory Peptide 2

H-9440.0005 5.0mg
EUR 273.00
Description: Sum Formula: C46H77N13O15S; CAS# [118850-72-9]

Anti-Inflammatory Peptide 2

H-9440.0025 25.0mg
EUR 998.00
Description: Sum Formula: C46H77N13O15S; CAS# [118850-72-9]

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280.00

Recombinant Human APOB Protein, Untagged, Native Protein-10mg

QP11047-10mg 10mg
EUR 4553.00

Recombinant Human B2M Protein, Untagged, Native Protein-10mg

QP11117-10mg 10mg
EUR 1415.00

Recombinant Human C1q Protein, Untagged, Native Protein-10mg

QP11228-10mg 10mg
EUR 4553.00

Recombinant Human C3c Protein, Untagged, Native Protein-10mg

QP11238-10mg 10mg
EUR 1161.00

Recombinant Human C4c Protein, Untagged, Native Protein-10mg

QP11240-10mg 10mg
EUR 3556.00

Recombinant Human CKM Protein, Untagged, Native Protein-10mg

QP11436-10mg 10mg
EUR 4806.00

Recombinant Human CRP Protein, Untagged, Native Protein-10mg

QP11511-10mg 10mg
EUR 916.00

Recombinant Human Ferritin Protein, Untagged, Native Protein-10mg

QP11867-10mg 10mg
EUR 2158.00

Recombinant Bovine Fibronectin Protein, Untagged, Native Protein-10mg

QP11880-10mg 10mg
EUR 1017.00

Recombinant Human Fibronectin Protein, Untagged, Native Protein-10mg

QP11881-10mg 10mg
EUR 1017.00

Recombinant Human Haptoglobin Protein, Untagged, Native Protein-10mg

QP12103-10mg 10mg
EUR 1959.00

Recombinant Human HbA1c Protein, Untagged, Native Protein-10mg

QP12117-10mg 10mg
EUR 2259.00

Recombinant Human HDL Protein, Untagged, Native Protein-10mg

QP12211-10mg 10mg
EUR 201.00

Recombinant other HSA Protein, Untagged, Pichia Pastoris-10mg

QP12314-10mg 10mg
EUR 155.00

Recombinant other HSA Recombinant Protein, Untagged, Rice-10mg

QP12317-10mg 10mg
EUR 163.00

Recombinant Human LDL Protein, Untagged, Native Protein-10mg

QP12550-10mg 10mg
EUR 163.00

Recombinant Human LTF Protein, Untagged, Native Protein-10mg

QP12595-10mg 10mg
EUR 4851.00

Recombinant Human LTF Holo Protein, Untagged, Rice-10mg

QP12596-10mg 10mg
EUR 155.00

Recombinant Human Myoglobin Protein, Untagged, Native Protein-10mg

QP12776-10mg 10mg
EUR 2059.00

Recombinant other SPA 33.4kDa Protein, Untagged, E.coli-10mg

QP13567-10mg 10mg
EUR 155.00

Recombinant other SPA Long Protein, Untagged, E.coli-10mg

QP13568-10mg 10mg
EUR 155.00

Recombinant other SPA-Cys Protein, Untagged, E.coli-10mg

QP13569-10mg 10mg
EUR 155.00

Recombinant other Streptavidin Protein, Untagged, Native Protein-10mg

QP13625-10mg 10mg
EUR 201.00

Recombinant Multi Species Trp Protein, Untagged, E.coli-10mg

QP13821-10mg 10mg
EUR 245.00

Recombinant other hCG Protein, Untagged, Native Protein-10mg

QP10664-10mg 10mg
EUR 245.00

Recombinant other Lipase A Protein, Untagged, E.coli-10mg

QP10772-10mg 10mg
EUR 155.00

Recombinant Human MG Protein, Untagged, Native Protein-10mg

QP10785-10mg 10mg
EUR 490.00

Recombinant Bovine Trypsin Protein, Untagged, Native Protein-10mg

QP10896-10mg 10mg
EUR 201.00

Recombinant Human UTI Protein, Untagged, Native Protein-10mg

QP10909-10mg 10mg
EUR 209.00

Recombinant Human A2M Protein, Untagged, Native Protein-10mg

QP10922-10mg 10mg
EUR 1624.00

Recombinant other Protein-L Protein, Untagged, E.coli-10mg

QP13168-10mg 10mg
EUR 201.00

Recombinant Human Collagen-III Protein, Untagged, Pichia Pastoris-10mg

QP11479-10mg 10mg
EUR 281.00

Recombinant other Cys-Protein-G Protein, Untagged, E.coli-10mg

QP11587-10mg 10mg
EUR 318.00

Recombinant other Cys-Protein-L Protein, Untagged, E.coli-10mg

QP11588-10mg 10mg
EUR 201.00

Recombinant other HSA Lipid free Protein, Untagged, Rice-10mg

QP12316-10mg 10mg
EUR 163.00

Recombinant other SPA-Cys His Protein, His, E.coli-10mg

QP13570-10mg 10mg
EUR 155.00

Recombinant other SPA-Cys Long Protein, Untagged, E.coli-10mg

QP13571-10mg 10mg
EUR 155.00

Recombinant other Protein-A/G Protein, His, E.coli-10mg

QP13163-10mg 10mg
EUR 201.00

Recombinant other Protein-G His Protein, His, E.coli-10mg

QP13167-10mg 10mg
EUR 318.00

Recombinant other Protein-L Cys Protein, Untagged, E.coli-10mg

QP13169-10mg 10mg
EUR 201.00

Recombinant other Protein Cys-A/G Protein, Untagged, E.coli-10mg

QP13161-10mg 10mg
EUR 201.00

Recombinant other Protein-A/G Cys Protein, Untagged, E.coli-10mg

QP13164-10mg 10mg
EUR 201.00

Recombinant other Protein-A/G/L Protein, Untagged, E.coli-10mg

QP13165-10mg 10mg
EUR 327.00

Recombinant other Cys-Protein-A/G/L Protein, Untagged, E.coli-10mg

QP11586-10mg 10mg
EUR 327.00

Recombinant other Protein-A/G/L-Cys Protein, Untagged, E.coli-10mg

QP13166-10mg 10mg
EUR 327.00

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349.00

Anti-Macrophage Inflammatory Protein 3 beta/Ccl19 Antibody

A01605-1 100ug/vial
EUR 294.00

Anti-inflammatory agent 1

HY-U00273 10mg
EUR 1455.00

anti-Macrophage Inflammatory Protein 1

YF-PA14542 50 ug
EUR 363.00
Description: Mouse polyclonal to Macrophage Inflammatory Protein 1

anti-Macrophage Inflammatory Protein 1

YF-PA24668 50 ul
EUR 334.00
Description: Mouse polyclonal to Macrophage Inflammatory Protein 1

Anti-Peptide YY/PYY Antibody

A04223-1 100ug/vial
EUR 334.00

Biotin-DHPE: (10mg)

60022 10MG
EUR 237.00
Description: Minimum order quantity: 1 unit of 10MG

Cellmaxin, 10mg/ml

C3314-006 6x1ml
EUR 212.00

Cellmaxin, 10mg/ml

C3314-020 20ml
EUR 327.00

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280.00

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280.00

Anti-Macrophage Inflammatory Protein 1 (4E7)

YF-MA10821 100 ug
EUR 363.00
Description: Mouse monoclonal to Macrophage Inflammatory Protein 1

 

Leave A Comment