Posted in Antibodies, Assay Kits, Biology Cells, cDNA, Clia Kits, Culture Cells, Devices, DNA, DNA Templates, DNA Testing, Elisa Kits, Enzymes, Equipments, Exosomes, Gels, Isotypes, Medium & Serums, NATtrol, Panel, Particles, PCR, Pcr Kits, Peptides, Reagents, Recombinant Proteins, Ria Kits, RNA, Test Kits, Vector & Virus, Western Blot
An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database.
An technique to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database.
A method to correlate the uninterpreted tandem mass spectra of peptides produced beneath low vitality (10-50 eV) collision circumstances with amino acid sequences throughout the Genpept database has been developed. On this system the protein database is searched to find out linear amino acid sequences inside a mass tolerance of ±1 u of the precursor ion molecular weight A cross-correlation function is then used to produce a measurement of similarity between the mass-to-charge ratios for the fragment ions predicted from amino acid sequences obtained from the database and the fragment ions seen throughout the tandem mass spectrum.
Usually, a distinction larger than 0.1 between the normalized cross-correlation options of the first- and second-ranked search outcomes signifies a worthwhile match between sequence and spectrum. Searches of species-specific protein databases with tandem mass spectra acquired from peptides obtained from the enzymatically digested complete proteins of E. coli and S.
cerevisiae cells allowed matching of the spectra to amino acid sequences inside proteins of these organisms. The technique described on this manuscript offers a useful methodology to interpret tandem mass spectra with acknowledged sequences in a protein database.
UHRF1BP1L Peptide |
|
MBS152886-5x005mg |
MyBiosource |
5x0.05mg |
EUR 770 |
UHRF1BP1L Antibody (Center) Blocking Peptide |
|
MBS9221797-INQUIRE |
MyBiosource |
INQUIRE |
Ask for price |
UHRF1BP1L |
|
CSB-CL025606HU1 |
Cusabio |
10 μg plasmid + 200μl Glycerol |
Ask for price |
UHRF1BP1L |
|
CSB-CL025606HU2 |
Cusabio |
10 μg plasmid + 200μl Glycerol |
Ask for price |
UHRF1BP1L |
|
MBS8564336-01mLAF405L |
MyBiosource |
0.1mL(AF405L) |
EUR 565 |
UHRF1BP1L |
|
MBS8564336-01mLAF405S |
MyBiosource |
0.1mL(AF405S) |
EUR 565 |
UHRF1BP1L |
|
MBS8564336-01mLAF610 |
MyBiosource |
0.1mL(AF610) |
EUR 565 |
UHRF1BP1L |
|
MBS8564336-01mLAF635 |
MyBiosource |
0.1mL(AF635) |
EUR 565 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) |
|
MBS6012429-02mL |
MyBiosource |
0.2(mL |
EUR 695 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) |
|
MBS6012429-5x02mL |
MyBiosource |
5x0.2mL |
EUR 2975 |
UHRF1BP1L Antibody |
|
6461-002mg |
ProSci |
0.02 mg |
EUR 206.18 |
- Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
|
|
Description: UHRF1BP1L Antibody: The Ubiquitin-like containing PHD and RING finger domains 1-binding protein 1-like (UHRF1BP1L) is closely related to UHRF1BP1, also known as ICBP90, a transcription and cell cycle regulator that specifically binds to the histone H3 N-terminal tail. While little is known of UHRF1BP1L, UHRF1BP1 is required for proper heterochromatin formation in mammalian cells. Furthermore, UHRF1BP1 is thought to be a pivotal target for the ERK1/2 signaling pathway to control the proliferation of Jurkat T cells, suggesting that UHRF1BP1L may also be involved in chromatin regulation and cell proliferation. |
UHRF1BP1L Antibody |
|
6461-01mg |
ProSci |
0.1 mg |
EUR 523.7 |
- Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
|
|
Description: UHRF1BP1L Antibody: The Ubiquitin-like containing PHD and RING finger domains 1-binding protein 1-like (UHRF1BP1L) is closely related to UHRF1BP1, also known as ICBP90, a transcription and cell cycle regulator that specifically binds to the histone H3 N-terminal tail. While little is known of UHRF1BP1L, UHRF1BP1 is required for proper heterochromatin formation in mammalian cells. Furthermore, UHRF1BP1 is thought to be a pivotal target for the ERK1/2 signaling pathway to control the proliferation of Jurkat T cells, suggesting that UHRF1BP1L may also be involved in chromatin regulation and cell proliferation. |
UHRF1BP1L Antibody |
|
25349-100ul |
SAB |
100ul |
EUR 468 |
UHRF1BP1L Antibody |
|
1-CSB-PA025606LA01HU |
Cusabio |
-
Ask for price
-
Ask for price
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
|
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
UHRF1BP1L Antibody |
|
E312594 |
EnoGene |
200ul |
EUR 275 |
|
Description: Available in various conjugation types. |
UHRF1BP1L Antibody |
|
MBS1499178-005mg |
MyBiosource |
0.05mg |
EUR 190 |
UHRF1BP1L Antibody |
|
MBS1499178-01mg |
MyBiosource |
0.1mg |
EUR 270 |
UHRF1BP1L Antibody |
|
MBS1499178-5x01mg |
MyBiosource |
5x0.1mg |
EUR 1205 |
UHRF1BP1L Antibody |
|
MBS150249-01mg |
MyBiosource |
0.1mg |
EUR 445 |
UHRF1BP1L Antibody |
|
MBS150249-5x01mg |
MyBiosource |
5x0.1mg |
EUR 1965 |
UHRF1BP1L Antibody |
|
MBS9401808-01mL |
MyBiosource |
0.1mL |
EUR 495 |
UHRF1BP1L Antibody |
|
MBS9401808-5x01mL |
MyBiosource |
5x0.1mL |
EUR 2075 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (AP) |
|
MBS6361256-02mL |
MyBiosource |
0.2mL |
EUR 980 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (AP) |
|
MBS6361256-5x02mL |
MyBiosource |
5x0.2mL |
EUR 4250 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (PE) |
|
MBS6361266-02mL |
MyBiosource |
0.2mL |
EUR 980 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (PE) |
|
MBS6361266-5x02mL |
MyBiosource |
5x0.2mL |
EUR 4250 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (APC) |
|
MBS6361257-02mL |
MyBiosource |
0.2mL |
EUR 980 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (APC) |
|
MBS6361257-5x02mL |
MyBiosource |
5x0.2mL |
EUR 4250 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (FITC) |
|
MBS6361259-02mL |
MyBiosource |
0.2mL |
EUR 980 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (FITC) |
|
MBS6361259-5x02mL |
MyBiosource |
5x0.2mL |
EUR 4250 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (Biotin) |
|
MBS6361258-02mL |
MyBiosource |
0.2mL |
EUR 980 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (Biotin) |
|
MBS6361258-5x02mL |
MyBiosource |
5x0.2mL |
EUR 4250 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 405) |
|
MBS6361261-01mL |
MyBiosource |
0.1mL |
EUR 980 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 405) |
|
MBS6361261-5x01mL |
MyBiosource |
5x0.1mL |
EUR 4250 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 490) |
|
MBS6361262-01mL |
MyBiosource |
0.1mL |
EUR 980 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 490) |
|
MBS6361262-5x01mL |
MyBiosource |
5x0.1mL |
EUR 4250 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 550) |
|
MBS6361263-01mL |
MyBiosource |
0.1mL |
EUR 980 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 550) |
|
MBS6361263-5x01mL |
MyBiosource |
5x0.1mL |
EUR 4250 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 650) |
|
MBS6361264-01mL |
MyBiosource |
0.1mL |
EUR 980 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 650) |
|
MBS6361264-5x01mL |
MyBiosource |
5x0.1mL |
EUR 4250 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 750) |
|
MBS6361265-01mL |
MyBiosource |
0.1mL |
EUR 980 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (MaxLight 750) |
|
MBS6361265-5x01mL |
MyBiosource |
5x0.1mL |
EUR 4250 |
UHRF1BP1L cDNA Clone |
|
MBS1272441-001mgPlasmid02mLGlycerolStock |
MyBiosource |
0.01mgPlasmid+0.2mLGlycerol-Stock |
EUR 330 |
UHRF1BP1L cDNA Clone |
|
MBS1272441-5x001mgPlasmid5x02mLGlycerolStock |
MyBiosource |
5x0.01mgPlasmid+5x0.2mLGlycerol-Stock |
EUR 1430 |
UHRF1BP1L cDNA Clone |
|
MBS1275299-001mgPlasmid02mLGlycerolStock |
MyBiosource |
0.01mgPlasmid+0.2mLGlycerol-Stock |
EUR 1065 |
UHRF1BP1L cDNA Clone |
|
MBS1275299-5x001mgPlasmid5x02mLGlycerolStock |
MyBiosource |
5x0.01mgPlasmid+5x0.2mLGlycerol-Stock |
EUR 4745 |
Uhrf1bp1l (untagged) - Mouse UHRF1 (ICBP90) binding protein 1-like (Uhrf1bp1l), (10ug) |
|
MC224500 |
Origene Technologies GmbH |
10 µg |
Ask for price |
Uhrf1bp1l (untagged ORF) - Rat UHRF1 binding protein 1-like (Uhrf1bp1l), (10 ug) |
|
RN206432 |
Origene Technologies GmbH |
10 µg |
Ask for price |
Mouse UHRF1BP1L siRNA |
|
20-abx938993 |
Abbexa |
-
Ask for price
-
Ask for price
|
|
- Shipped within 5-10 working days.
|
Human UHRF1BP1L siRNA |
|
20-abx938994 |
Abbexa |
-
Ask for price
-
Ask for price
|
|
- Shipped within 5-10 working days.
|
UHRF1BP1L siRNA (Human) |
|
MBS827751-15nmol |
MyBiosource |
15nmol |
EUR 405 |
UHRF1BP1L siRNA (Human) |
|
MBS827751-30nmol |
MyBiosource |
30nmol |
EUR 565 |
UHRF1BP1L siRNA (Human) |
|
MBS827751-5x30nmol |
MyBiosource |
5x30nmol |
EUR 2450 |
UHRF1BP1L siRNA (Mouse) |
|
MBS8229413-15nmol |
MyBiosource |
15nmol |
EUR 405 |
UHRF1BP1L siRNA (Mouse) |
|
MBS8229413-30nmol |
MyBiosource |
30nmol |
EUR 565 |
UHRF1BP1L siRNA (Mouse) |
|
MBS8229413-5x30nmol |
MyBiosource |
5x30nmol |
EUR 2450 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (Azide free) (HRP) |
|
MBS6361260-02mL |
MyBiosource |
0.2mL |
EUR 980 |
UHRF1BP1L, ID (UHRF1BP1L, KIAA0701, UHRF1-binding protein 1-like) (Azide free) (HRP) |
|
MBS6361260-5x02mL |
MyBiosource |
5x0.2mL |
EUR 4250 |
anti- UHRF1BP1L antibody |
|
FNab09246 |
FN Test |
100µg |
EUR 702 |
- Recommended dilution: WB: 1:500-1:5000
- IP: 1:500-1:5000
- Immunogen: UHRF1 binding protein 1-like
- Uniprot ID: A0JNW5
- Gene ID: 23074
|
|
Description: Antibody raised against UHRF1BP1L |
Uhrf1bp1l (Myc-DDK-tagged) - Mouse UHRF1 (ICBP90) binding protein 1-like (Uhrf1bp1l) |
|
MR217370 |
Origene Technologies GmbH |
10 µg |
Ask for price |
Uhrf1bp1l (GFP-tagged) - Mouse UHRF1 (ICBP90) binding protein 1-like (Uhrf1bp1l), (10ug) |
|
MG217370 |
Origene Technologies GmbH |
10 µg |
Ask for price |
UHRF1BP1L cloning plasmid |
|
CSB-CL025606HU1-10ug |
Cusabio |
10ug |
EUR 451.2 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1569
- Sequence: atggccgggatcatcaagaaacaaatcttgaagcacctctccagatttaccaaaaatttatctcctgacaagataaatctaagtacccttaaaggagaaggtgaactgaagaatttggagttggatgaagaagtactccagaatatgttggatttgccaacatggcttgctatca
- Show more
|
|
Description: A cloning plasmid for the UHRF1BP1L gene. |
UHRF1BP1L cloning plasmid |
|
CSB-CL025606HU2-10ug |
Cusabio |
10ug |
EUR 1308 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3033
- Sequence: ATGGCCGGGATCATCAAGAAACAAATCTTGAAGCACCTCTCCAGATTTACCAAAAATTTATCTCCTGACAAGATAAATCTAAGTACCCTTAAAGGAGAAGGTGAACTGAAGAATTTGGAGTTGGATGAAGAAGTACTCCAGAATATGTTGGATTTGCCAACATGGCTTGCTATCA
- Show more
|
|
Description: A cloning plasmid for the UHRF1BP1L gene. |
UHRF1BP1L Antibody (Center) |
|
MBS9201066-008mL |
MyBiosource |
0.08mL |
EUR 210 |
UHRF1BP1L Antibody (Center) |
|
MBS9201066-04mL |
MyBiosource |
0.4mL |
EUR 430 |
UHRF1BP1L Antibody (Center) |
|
MBS9201066-5x04mL |
MyBiosource |
5x0.4mL |
EUR 1910 |
UHRF1BP1L (untagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 1 |
|
SC304212 |
Origene Technologies GmbH |
10 µg |
Ask for price |
UHRF1BP1L (untagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 2 |
|
SC301130 |
Origene Technologies GmbH |
10 µg |
Ask for price |
Uhrf1bp1l (Myc-DDK-tagged ORF) - Rat UHRF1 binding protein 1-like (Uhrf1bp1l), (10 ug) |
|
RR206432 |
Origene Technologies GmbH |
10 µg |
Ask for price |
UHRF1BP1L Polyclonal Antibody |
|
A61674 |
EpiGentek |
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
|
-
100 µg
-
20 ul
-
50 ul
-
100 ul
|
Polyclonal UHRF1BP1L Antibody |
|
APR06720G |
Leading Biology |
0.1 mg |
EUR 790.8 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UHRF1BP1L . This antibody is tested and proven to work in the following applications: |
UHRF1BP1L (GFP-tagged) - Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 1 |
|
RG217227 |
Origene Technologies GmbH |
10 µg |
Ask for price |
UHRF1BP1L (GFP-tagged) - Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 2 |
|
RG221416 |
Origene Technologies GmbH |
10 µg |
Ask for price |
Mouse UHRF1BP1L shRNA Plasmid |
|
20-abx978348 |
Abbexa |
-
Ask for price
-
Ask for price
|
|
- Shipped within 15-20 working days.
|
Human UHRF1BP1L shRNA Plasmid |
|
20-abx957978 |
Abbexa |
-
Ask for price
-
Ask for price
|
|
- Shipped within 15-20 working days.
|
UHRF1BP1L (Myc-DDK-tagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 2 |
|
RC221416 |
Origene Technologies GmbH |
10 µg |
Ask for price |
UHRF1BP1L (Myc-DDK-tagged)-Human UHRF1 binding protein 1-like (UHRF1BP1L), transcript variant 1 |
|
RC217227 |
Origene Technologies GmbH |
10 µg |
Ask for price |
Lenti ORF clone of Uhrf1bp1l (mGFP-tagged) - Mouse UHRF1 (ICBP90) binding protein 1-like (Uhrf1bp1l) |
|
MR217370L4 |
Origene Technologies GmbH |
10 µg |
Ask for price |
Uhrf1bp1l ORF Vector (Rat) (pORF) |
|
ORF078615 |
ABM |
1.0 ug DNA |
EUR 2496 |
UHRF1BP1L Antibody, HRP conjugated |
|
1-CSB-PA025606LB01HU |
Cusabio |
-
Ask for price
-
Ask for price
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
|
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
UHRF1BP1L Antibody, HRP conjugated |
|
MBS1493197-005mg |
MyBiosource |
0.05mg |
EUR 190 |
UHRF1BP1L Antibody, HRP conjugated |
|
MBS1493197-01mg |
MyBiosource |
0.1mg |
EUR 270 |
UHRF1BP1L Antibody, HRP conjugated |
|
MBS1493197-5x01mg |
MyBiosource |
5x0.1mg |
EUR 1205 |
UHRF1BP1L Antibody, FITC conjugated |
|
1-CSB-PA025606LC01HU |
Cusabio |
-
Ask for price
-
Ask for price
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
|
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
UHRF1BP1L Antibody, FITC conjugated |
|
MBS1493816-005mg |
MyBiosource |
0.05mg |
EUR 190 |
CHARMM: the biomolecular simulation program.
CHARMM (Chemistry at HARvard Molecular Mechanics) is a extraordinarily versatile and broadly used molecular simulation program.
It has been developed over the previous three a few years with a primary give consideration to molecules of natural curiosity, along with proteins, peptides, lipids, nucleic acids, carbohydrates, and small molecule ligands, as they occur in reply, crystals, and membrane environments.
For the look at of such methods, this method offers a giant suite of computational devices that embrace fairly just a few conformational and path sampling methods, free vitality estimators, molecular minimization, dynamics, and analysis strategies, and model-building capabilities.
The CHARMM program is related to points involving a a lot wider class of many-particle methods.
Calculations with CHARMM could also be carried out using numerous fully totally different vitality options and fashions, from blended quantum mechanical-molecular mechanical stress fields, to all-atom classical potential vitality options with particular solvent and quite a few boundary circumstances, to implicit solvent and membrane fashions.
This method has been ported to fairly just a few platforms in every serial and parallel architectures. This textual content offers an overview of this method as a result of it exists within the current day with an emphasis on developments as a result of the publication of the distinctive CHARMM article in 1983.
Ghrelin is a growth-hormone-releasing acylated peptide from stomach.
Small synthetic molecules often known as growth-hormone secretagogues (GHSs) stimulate the discharge of improvement hormone (GH) from the pituitary. They act by means of GHS-R, a G-protein-coupled receptor for which the ligand is unknown.
Present cloning of GHS-R strongly implies that an endogenous ligand for the receptor does exist and that there is a mechanism for regulating GH launch that is distinct from its regulation by hypothalamic growth-hormone-releasing hormone (GHRH).
We now report the purification and identification in rat stomach of an endogenous ligand explicit for GHS-R.
The purified ligand is a peptide of 28 amino acids, by which the serine three residue is n-octanoylated. The acylated peptide notably releases GH every in vivo and in vitro, and O-n-octanoylation at serine three is essential for the train.
We designate the GH-releasing peptide ‘ghrelin’ (ghre is the Proto-Indo-European root of the phrase ‘develop’). Human ghrelin is homologous to rat ghrelin apart from two amino acids.
The incidence of ghrelin in every rat and human signifies that GH launch from the pituitary may be regulated not solely by hypothalamic GHRH, however as well as by ghrelin.
anti-Macrophage Inflammatory Protein 1 |
|
YF-PA14542 |
Abfrontier |
50 ug |
EUR 435.6 |
|
Description: Mouse polyclonal to Macrophage Inflammatory Protein 1 |
Anti-Macrophage Inflammatory Protein 1 (4E7) |
|
YF-MA10821 |
Abfrontier |
100 ug |
EUR 435.6 |
|
Description: Mouse monoclonal to Macrophage Inflammatory Protein 1 |
anti-Macrophage Inflammatory Protein 1 beta |
|
YF-PA24669 |
Abfrontier |
50 ul |
EUR 400.8 |
|
Description: Mouse polyclonal to Macrophage Inflammatory Protein 1 beta |
anti-Macrophage Inflammatory Protein 1 beta |
|
YF-PA14543 |
Abfrontier |
100 ug |
EUR 483.6 |
|
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 1 beta |
anti-Macrophage inflammatory protein 5 |
|
YF-PA24672 |
Abfrontier |
50 ul |
EUR 400.8 |
|
Description: Mouse polyclonal to Macrophage inflammatory protein 5 |
anti-Macrophage Inflammatory Protein 4 |
|
YF-PA24674 |
Abfrontier |
50 ul |
EUR 400.8 |
|
Description: Mouse polyclonal to Macrophage Inflammatory Protein 4 |
anti-Macrophage inflammatory protein 5 |
|
YF-PA20144 |
Abfrontier |
50 ug |
EUR 435.6 |
|
Description: Mouse polyclonal to Macrophage inflammatory protein 5 |
anti-Macrophage inflammatory protein 5 |
|
YF-PA20145 |
Abfrontier |
100 ul |
EUR 483.6 |
|
Description: Rabbit polyclonal to Macrophage inflammatory protein 5 |
anti-Macrophage inflammatory protein 5 |
|
YF-PA20146 |
Abfrontier |
100 ug |
EUR 483.6 |
|
Description: Rabbit polyclonal to Macrophage inflammatory protein 5 |
anti-Macrophage inflammatory protein 5 |
|
YF-PA14551 |
Abfrontier |
100 ul |
EUR 483.6 |
|
Description: Rabbit polyclonal to Macrophage inflammatory protein 5 |
anti-Macrophage inflammatory protein 5 |
|
YF-PA14552 |
Abfrontier |
100 ug |
EUR 483.6 |
|
Description: Rabbit polyclonal to Macrophage inflammatory protein 5 |
anti-Macrophage Inflammatory Protein 4 |
|
YF-PA14553 |
Abfrontier |
100 ul |
EUR 483.6 |
|
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 4 |
anti-Macrophage Inflammatory Protein 4 |
|
YF-PA14554 |
Abfrontier |
100 ug |
EUR 483.6 |
|
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 4 |
anti-Macrophage Inflammatory Protein 3 |
|
YF-PA14559 |
Abfrontier |
50 ug |
EUR 435.6 |
|
Description: Mouse polyclonal to Macrophage Inflammatory Protein 3 |
anti-Macrophage Inflammatory Protein 3 |
|
YF-PA14560 |
Abfrontier |
100 ul |
EUR 483.6 |
|
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 3 |
anti-Macrophage Inflammatory Protein 3 |
|
YF-PA14561 |
Abfrontier |
100 ug |
EUR 483.6 |
|
Description: Rabbit polyclonal to Macrophage Inflammatory Protein 3 |
Anti-Macrophage Inflammatory Protein 1 beta antibody |
|
MBS175746-01mg |
MyBiosource |
0.1mg |
EUR 450 |
Anti-Macrophage Inflammatory Protein 1 beta antibody |
|
MBS175746-5x01mg |
MyBiosource |
5x0.1mg |
EUR 1870 |
Allograft inflammatory factor 1 |
|
AP78902 |
SAB |
1mg |
EUR 2640 |
|
|
Allograft inflammatory factor 1 |
|
AP80262 |
SAB |
1mg |
EUR 2640 |
|
|
Allograft inflammatory factor 1 |
|
AP80348 |
SAB |
1mg |
EUR 2640 |
|
|
Allograft inflammatory factor 1 |
|
AP80350 |
SAB |
1mg |
EUR 2640 |
|
|
Allograft inflammatory factor 1 |
|
AP80469 |
SAB |
1mg |
EUR 2640 |
|
|
Anti-Macrophage inflammatory protein 5 (1D7) |
|
YF-MA15363 |
Abfrontier |
100 ug |
EUR 435.6 |
|
Description: Mouse monoclonal to Macrophage inflammatory protein 5 |
Anti-Macrophage inflammatory protein 5 (3H1) |
|
YF-MA15365 |
Abfrontier |
100 ug |
EUR 435.6 |
|
Description: Mouse monoclonal to Macrophage inflammatory protein 5 |
Anti-Macrophage inflammatory protein 5 (3B7) |
|
YF-MA15366 |
Abfrontier |
100 ug |
EUR 435.6 |
|
Description: Mouse monoclonal to Macrophage inflammatory protein 5 |
Anti-Macrophage inflammatory protein 5 (3B1) |
|
YF-MA15367 |
Abfrontier |
100 ug |
EUR 435.6 |
|
Description: Mouse monoclonal to Macrophage inflammatory protein 5 |
Anti-Macrophage Inflammatory Protein 4 (2C6) |
|
YF-MA15369 |
Abfrontier |
100 ug |
EUR 435.6 |
|
Description: Mouse monoclonal to Macrophage Inflammatory Protein 4 |
Anti-Macrophage inflammatory protein 5 (3D3) |
|
YF-MA19031 |
Abfrontier |
100 ug |
EUR 435.6 |
|
Description: Mouse monoclonal to Macrophage inflammatory protein 5 |
Anti-Macrophage Inflammatory Protein 1 beta/CCL4 Antibody |
|
PA1379 |
BosterBio |
100ug/vial |
EUR 154 |
|
|
|
Description: Western blot, 0.1-0.5μg/ml, Mouse |
Anti-Macrophage inflammatory protein 5 (4G10) |
|
YF-MA15364 |
Abfrontier |
100 ug |
EUR 435.6 |
|
Description: Mouse monoclonal to Macrophage inflammatory protein 5 |
Inflammatory profilin Antibody |
|
abx110412-100l |
Abbexa |
100 µl |
EUR 162.5 |
Inflammatory profilin Antibody |
|
20-abx110412 |
Abbexa |
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
|
-
20 ug
-
50 ug
-
100 ug
-
200 ug
-
1 mg
|
- Shipped within 5-10 working days.
|
Anti- Macrophage Inflammatory Protein-1 Alpha (MIP-1 alpha) Antibody |
|
GWB-464602 |
GenWay Biotech |
0.05 mg |
Ask for price |
- Anti- Macrophage Inflammatory Protein-1 Alpha (MIP-1 alpha) Antibody was previously known under catalogue number 18-251-404207 was previously known under catalogue number 18-251-404207
|
Anti-Macrophage Inflammatory Protein 3 beta (3E9) |
|
YF-MA15370 |
Abfrontier |
200 ul |
EUR 435.6 |
|
Description: Mouse monoclonal to Macrophage Inflammatory Protein 3 beta |
ALLOGRAFT - INFLAMMATORY FACTOR-1 (AIF-1), Antibody |
|
GWB-621C02 |
GenWay Biotech |
0.1 mg |
Ask for price |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx002264-100l |
Abbexa |
100 µl |
EUR 400 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx002264-20l |
Abbexa |
20 µl |
EUR 175 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx002264-50l |
Abbexa |
50 µl |
EUR 275 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx001285-100l |
Abbexa |
100 µl |
EUR 400 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
20-abx001285 |
Abbexa |
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
|
-
20 ul
-
50 ul
-
100 ul
-
200 ul
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx001285-20l |
Abbexa |
20 µl |
EUR 175 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx001285-50l |
Abbexa |
50 µl |
EUR 275 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx025719-400l |
Abbexa |
400 µl |
EUR 518.75 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx025719-400ul |
Abbexa |
400 ul |
EUR 627.6 |
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx025719-80l |
Abbexa |
80 µl |
EUR 281.25 |
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx037687-100ug |
Abbexa |
100 ug |
EUR 469.2 |
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx037687-96tests |
Abbexa |
96 tests |
EUR 337.5 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx037794-100ug |
Abbexa |
100 ug |
EUR 469.2 |
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx037794-96tests |
Abbexa |
96 tests |
EUR 337.5 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx109254-100l |
Abbexa |
100 µl |
EUR 162.5 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
20-abx109254 |
Abbexa |
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
|
-
20 ug
-
50 ug
-
100 ug
-
200 ug
-
1 mg
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx109516-100l |
Abbexa |
100 µl |
EUR 162.5 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
20-abx109516 |
Abbexa |
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
|
-
20 ug
-
50 ug
-
100 ug
-
200 ug
-
1 mg
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx110941-100l |
Abbexa |
100 µl |
EUR 612.5 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
20-abx110941 |
Abbexa |
-
Ask for price
-
Ask for price
|
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx131921-100g |
Abbexa |
100 µg |
EUR 850 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
20-abx131921 |
Abbexa |
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
|
-
20 ug
-
50 ug
-
100 ug
-
200 ug
-
1 mg
|
- Shipped within 5-7 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx131921-20g |
Abbexa |
20 µg |
EUR 375 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx131921-5g |
Abbexa |
5 µg |
EUR 287.5 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx103213-100l |
Abbexa |
100 µl |
EUR 225 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
20-abx103213 |
Abbexa |
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
|
-
10 ug
-
50 ug
-
100 ug
-
200 ug
-
1 mg
|
- Shipped within 5-7 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx103213-1ml |
Abbexa |
1 ml |
EUR 525 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx103213-200l |
Abbexa |
200 µl |
EUR 275 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx103214-100l |
Abbexa |
100 µl |
EUR 237.5 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
20-abx103214 |
Abbexa |
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
|
-
20 ug
-
50 ug
-
100 ug
-
200 ug
-
1 mg
|
- Shipped within 5-7 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx103214-1ml |
Abbexa |
1 ml |
EUR 625 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx103214-200l |
Abbexa |
200 µl |
EUR 300 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx103215-100l |
Abbexa |
100 µl |
EUR 275 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
20-abx103215 |
Abbexa |
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
|
-
10 ug
-
50 ug
-
100 ug
-
200 ug
-
1 mg
|
- Shipped within 5-7 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx103215-1ml |
Abbexa |
1 ml |
EUR 775 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx103215-200l |
Abbexa |
200 µl |
EUR 350 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx103216-100l |
Abbexa |
100 µl |
EUR 287.5 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
20-abx103216 |
Abbexa |
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
|
-
10 ug
-
50 ug
-
100 ug
-
200 ug
-
1 mg
|
- Shipped within 5-7 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx103216-1ml |
Abbexa |
1 ml |
EUR 812.5 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx103216-200l |
Abbexa |
200 µl |
EUR 362.5 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx104925-100g |
Abbexa |
100 µg |
EUR 850 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
20-abx104925 |
Abbexa |
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
|
-
10 ug
-
50 ug
-
100 ug
-
200 ug
-
1 mg
|
- Shipped within 5-7 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx104925-20g |
Abbexa |
20 µg |
EUR 287.5 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx104925-50g |
Abbexa |
50 µg |
EUR 375 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
20-abx175326 |
Abbexa |
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
-
Ask for price
|
-
10 ug
-
50 ug
-
100 ug
-
200 ug
-
1 mg
|
- Shipped within 5-12 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx175326-1096tests |
Abbexa |
10 × 96 tests |
EUR 525 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx175326-596tests |
Abbexa |
5 × 96 tests |
EUR 275 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx175326-96tests |
Abbexa |
96 tests |
EUR 225 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
20-abx175327 |
Abbexa |
-
Ask for price
-
Ask for price
|
|
|
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx147003-1096tests |
Abbexa |
10 × 96 tests |
Ask for price |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx147003-596tests |
Abbexa |
5 × 96 tests |
Ask for price |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx147003-96tests |
Abbexa |
96 tests |
EUR 350 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx148081-1096tests |
Abbexa |
10 × 96 tests |
Ask for price |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
|
abx148081-596tests |
Abbexa |
5 × 96 tests |
EUR 387.5 |