An technique to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database.

A method to correlate the uninterpreted tandem mass spectra of peptides produced beneath low vitality (10-50 eV) collision circumstances with amino acid sequences throughout the Genpept database has been developed. On this system the protein database is searched to find out linear amino acid sequences inside a mass tolerance of ±1 u of the precursor ion molecular weight A cross-correlation function is then used to produce a measurement of similarity between the mass-to-charge ratios for the fragment ions predicted from amino acid sequences obtained from the database and the fragment ions seen throughout the tandem mass spectrum.

 

Usually, a distinction larger than 0.1 between the normalized cross-correlation options of the first- and second-ranked search outcomes signifies a worthwhile match between sequence and spectrum. Searches of species-specific protein databases with tandem mass spectra acquired from peptides obtained from the enzymatically digested complete proteins of E. coli and S.

 

cerevisiae cells allowed matching of the spectra to amino acid sequences inside proteins of these organisms. The technique described on this manuscript offers a useful methodology to interpret tandem mass spectra with acknowledged sequences in a protein database.

 

UHRF1BP1L siRNA
20-abx938994	Abbexa	EUR 661.20 EUR 878.40	15 nmol 30 nmol
Shipped within 5-10 working days.

UHRF1BP1L Antibody
1-CSB-PA025606LA01HU	Cusabio	EUR 380.40 EUR 402.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is Unconjugated. Tested in the following application: ELISA

UHRF1BP1L Antibody
6461-002mg	ProSci	0.02 mg	EUR 206.18
Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: UHRF1BP1L Antibody: The Ubiquitin-like containing PHD and RING finger domains 1-binding protein 1-like (UHRF1BP1L) is closely related to UHRF1BP1, also known as ICBP90, a transcription and cell cycle regulator that specifically binds to the histone H3 N-terminal tail. While little is known of UHRF1BP1L, UHRF1BP1 is required for proper heterochromatin formation in mammalian cells. Furthermore, UHRF1BP1 is thought to be a pivotal target for the ERK1/2 signaling pathway to control the proliferation of Jurkat T cells, suggesting that UHRF1BP1L may also be involved in chromatin regulation and cell proliferation.

UHRF1BP1L Antibody
6461-01mg	ProSci	0.1 mg	EUR 523.7
Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: UHRF1BP1L Antibody: The Ubiquitin-like containing PHD and RING finger domains 1-binding protein 1-like (UHRF1BP1L) is closely related to UHRF1BP1, also known as ICBP90, a transcription and cell cycle regulator that specifically binds to the histone H3 N-terminal tail. While little is known of UHRF1BP1L, UHRF1BP1 is required for proper heterochromatin formation in mammalian cells. Furthermore, UHRF1BP1 is thought to be a pivotal target for the ERK1/2 signaling pathway to control the proliferation of Jurkat T cells, suggesting that UHRF1BP1L may also be involved in chromatin regulation and cell proliferation.

UHRF1BP1L Antibody
25349-100ul	SAB	100ul	EUR 468

UHRF1BP1L cloning plasmid
CSB-CL025606HU1-10ug	Cusabio	10ug	EUR 451.2
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1569 Sequence: atggccgggatcatcaagaaacaaatcttgaagcacctctccagatttaccaaaaatttatctcctgacaagataaatctaagtacccttaaaggagaaggtgaactgaagaatttggagttggatgaagaagtactccagaatatgttggatttgccaacatggcttgctatca Show more
Description: A cloning plasmid for the UHRF1BP1L gene.

UHRF1BP1L cloning plasmid
CSB-CL025606HU2-10ug	Cusabio	10ug	EUR 1308
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3033 Sequence: ATGGCCGGGATCATCAAGAAACAAATCTTGAAGCACCTCTCCAGATTTACCAAAAATTTATCTCCTGACAAGATAAATCTAAGTACCCTTAAAGGAGAAGGTGAACTGAAGAATTTGGAGTTGGATGAAGAAGTACTCCAGAATATGTTGGATTTGCCAACATGGCTTGCTATCA Show more
Description: A cloning plasmid for the UHRF1BP1L gene.

Polyclonal UHRF1BP1L Antibody
APR06720G	Leading Biology	0.1 mg	EUR 790.8
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UHRF1BP1L . This antibody is tested and proven to work in the following applications:

anti- UHRF1BP1L antibody
FNab09246	FN Test	100µg	EUR 702
Recommended dilution: WB: 1:500-1:5000 IP: 1：500-1：5000 Immunogen: UHRF1 binding protein 1-like Uniprot ID: A0JNW5 Gene ID: 23074
Description: Antibody raised against UHRF1BP1L

Anti-UHRF1BP1L antibody
PAab09246	Lifescience Market	100 ug	EUR 494.4

UHRF1BP1L Polyclonal Antibody
A61674-020	EpiGentek	20 ul	EUR 117.7

UHRF1BP1L Polyclonal Antibody
A61674-050	EpiGentek	50 ul	EUR 302.5

UHRF1BP1L Polyclonal Antibody
A61674-100	EpiGentek	100 ul	EUR 423.5

UHRF1BP1L Polyclonal Antibody
A61674	EpiGentek	EUR 684.66 EUR 117.70 EUR 302.50 EUR 423.50	100 µg 20 ul 50 ul 100 ul

Mouse UHRF1BP1L shRNA Plasmid
20-abx978348	Abbexa	EUR 961.20 EUR 1345.20	150 µg 300 µg
Shipped within 15-20 working days.

Human UHRF1BP1L shRNA Plasmid
20-abx957978	Abbexa	EUR 961.20 EUR 1345.20	150 µg 300 µg
Shipped within 15-20 working days.

UHRF1BP1L Antibody, HRP conjugated
1-CSB-PA025606LB01HU	Cusabio	EUR 380.40 EUR 402.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UHRF1BP1L Antibody, FITC conjugated
1-CSB-PA025606LC01HU	Cusabio	EUR 380.40 EUR 402.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UHRF1BP1L Antibody, Biotin conjugated
1-CSB-PA025606LD01HU	Cusabio	EUR 380.40 EUR 402.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UHRF1BP1L. Recognizes UHRF1BP1L from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

UHRF1BP1L ELISA KIT|Human
EF004066	Lifescience Market	96 Tests	EUR 826.8

Uhrf1bp1l ORF Vector (Rat) (pORF)
ORF078615	ABM	1.0 ug DNA	EUR 2496

Uhrf1bp1l ORF Vector (Mouse) (pORF)
ORF061024	ABM	1.0 ug DNA	EUR 1886.4

UHRF1BP1L ORF Vector (Human) (pORF)
ORF014885	ABM	1.0 ug DNA	EUR 424.8

UHRF1BP1L ORF Vector (Human) (pORF)
ORF011318	ABM	1.0 ug DNA	EUR 114

UHRF1BP1L Polyclonal Antibody, Biotin Conjugated
A61675-050	EpiGentek	50 ul	EUR 302.5

UHRF1BP1L Polyclonal Antibody, Biotin Conjugated
A61675-100	EpiGentek	100 ul	EUR 423.5

UHRF1BP1L Polyclonal Antibody, FITC Conjugated
A61676-050	EpiGentek	50 ul	EUR 302.5

UHRF1BP1L Polyclonal Antibody, FITC Conjugated
A61676-100	EpiGentek	100 ul	EUR 423.5

UHRF1BP1L Polyclonal Antibody, HRP Conjugated
A61677-050	EpiGentek	50 ul	EUR 302.5

UHRF1BP1L Polyclonal Antibody, HRP Conjugated
A61677-100	EpiGentek	100 ul	EUR 423.5

UHRF1BP1L Polyclonal Antibody, Biotin Conjugated
A61675	EpiGentek	EUR 684.66 EUR 302.50 EUR 423.50	100 µg 50 ul 100 ul

UHRF1BP1L Polyclonal Antibody, FITC Conjugated
A61676	EpiGentek	EUR 684.66 EUR 302.50 EUR 423.50	100 µg 50 ul 100 ul

UHRF1BP1L Polyclonal Antibody, HRP Conjugated
A61677	EpiGentek	EUR 684.66 EUR 302.50 EUR 423.50	100 µg 50 ul 100 ul

Canine C-Peptide ELISA Kit
DLR-C-Peptide-c-48T	DL Develop	48T	EUR 632.4
Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit
DLR-C-Peptide-c-96T	DL Develop	96T	EUR 825.6
Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit
DLR-C-Peptide-Hu-48T	DL Develop	48T	EUR 477.6
Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit
DLR-C-Peptide-Hu-96T	DL Develop	96T	EUR 613.2
Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit
DLR-C-Peptide-Mu-48T	DL Develop	48T	EUR 540
Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit
DLR-C-Peptide-Mu-96T	DL Develop	96T	EUR 698.4
Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit
DLR-C-Peptide-Ra-48T	DL Develop	48T	EUR 560.4
Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit
DLR-C-Peptide-Ra-96T	DL Develop	96T	EUR 726
Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit
RDR-C-Peptide-c-48Tests	Reddot Biotech	48 Tests	EUR 668.4

Canine C-Peptide ELISA Kit
RDR-C-Peptide-c-96Tests	Reddot Biotech	96 Tests	EUR 928.8

Human C-Peptide ELISA Kit
RDR-C-Peptide-Hu-48Tests	Reddot Biotech	48 Tests	EUR 484.8

Human C-Peptide ELISA Kit
RDR-C-Peptide-Hu-96Tests	Reddot Biotech	96 Tests	EUR 667.2

Mouse C-Peptide ELISA Kit
RDR-C-Peptide-Mu-48Tests	Reddot Biotech	48 Tests	EUR 558

Mouse C-Peptide ELISA Kit
RDR-C-Peptide-Mu-96Tests	Reddot Biotech	96 Tests	EUR 771.6

Rat C-Peptide ELISA Kit
RDR-C-Peptide-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583.2

Rat C-Peptide ELISA Kit
RDR-C-Peptide-Ra-96Tests	Reddot Biotech	96 Tests	EUR 806.4

Canine C-Peptide ELISA Kit
RD-C-Peptide-c-48Tests	Reddot Biotech	48 Tests	EUR 639.6

Canine C-Peptide ELISA Kit
RD-C-Peptide-c-96Tests	Reddot Biotech	96 Tests	EUR 888

Human C-Peptide ELISA Kit
RD-C-Peptide-Hu-48Tests	Reddot Biotech	48 Tests	EUR 464.4

Human C-Peptide ELISA Kit
RD-C-Peptide-Hu-96Tests	Reddot Biotech	96 Tests	EUR 638.4

Mouse C-Peptide ELISA Kit
RD-C-Peptide-Mu-48Tests	Reddot Biotech	48 Tests	EUR 535.2

Mouse C-Peptide ELISA Kit
RD-C-Peptide-Mu-96Tests	Reddot Biotech	96 Tests	EUR 738

Rat C-Peptide ELISA Kit
RD-C-Peptide-Ra-48Tests	Reddot Biotech	48 Tests	EUR 558

Rat C-Peptide ELISA Kit
RD-C-Peptide-Ra-96Tests	Reddot Biotech	96 Tests	EUR 771.6

UHRF1BP1L sgRNA CRISPR Lentivector set (Human)
K2586801	ABM	3 x 1.0 ug	EUR 406.8

Uhrf1bp1l sgRNA CRISPR Lentivector set (Mouse)
K4538801	ABM	3 x 1.0 ug	EUR 406.8

Uhrf1bp1l sgRNA CRISPR Lentivector set (Rat)
K6609801	ABM	3 x 1.0 ug	EUR 406.8

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody
abx028888-400ul	Abbexa	400 ul	EUR 627.6
Shipped within 5-10 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody
abx028888-80l	Abbexa	80 µl	EUR 343.2
Shipped within 5-10 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody
20-abx305894	Abbexa	EUR 493.20 EUR 2214.00 EUR 718.80 EUR 218.40 EUR 360.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

UHRF1-Binding Protein 1-Like (UHRF1BP1L) Antibody
abx239246-100ug	Abbexa	100 ug	EUR 661.2
Shipped within 5-12 working days.

UHRF1BP1L sgRNA CRISPR Lentivector (Human) (Target 1)
K2586802	ABM	1.0 ug DNA	EUR 184.8

UHRF1BP1L sgRNA CRISPR Lentivector (Human) (Target 2)
K2586803	ABM	1.0 ug DNA	EUR 184.8

UHRF1BP1L sgRNA CRISPR Lentivector (Human) (Target 3)
K2586804	ABM	1.0 ug DNA	EUR 184.8

Uhrf1bp1l sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4538802	ABM	1.0 ug DNA	EUR 184.8

Uhrf1bp1l sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4538803	ABM	1.0 ug DNA	EUR 184.8

Uhrf1bp1l sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4538804	ABM	1.0 ug DNA	EUR 184.8

Uhrf1bp1l sgRNA CRISPR Lentivector (Rat) (Target 1)
K6609802	ABM	1.0 ug DNA	EUR 184.8

Uhrf1bp1l sgRNA CRISPR Lentivector (Rat) (Target 2)
K6609803	ABM	1.0 ug DNA	EUR 184.8

Uhrf1bp1l sgRNA CRISPR Lentivector (Rat) (Target 3)
K6609804	ABM	1.0 ug DNA	EUR 184.8

UHRF1BP1L Protein Vector (Human) (pPB-C-His)
PV045269	ABM	500 ng	EUR 394.8

UHRF1BP1L Protein Vector (Human) (pPB-N-His)
PV045270	ABM	500 ng	EUR 394.8

UHRF1BP1L Protein Vector (Human) (pPM-C-HA)
PV045271	ABM	500 ng	EUR 394.8

UHRF1BP1L Protein Vector (Human) (pPM-C-His)
PV045272	ABM	500 ng	EUR 394.8

UHRF1BP1L Protein Vector (Human) (pPB-C-His)
PV059537	ABM	500 ng	EUR 577.2

UHRF1BP1L Protein Vector (Human) (pPB-N-His)
PV059538	ABM	500 ng	EUR 577.2

UHRF1BP1L Protein Vector (Human) (pPM-C-HA)
PV059539	ABM	500 ng	EUR 577.2

UHRF1BP1L Protein Vector (Human) (pPM-C-His)
PV059540	ABM	500 ng	EUR 577.2

UHRF1BP1L Protein Vector (Mouse) (pPB-C-His)
PV244094	ABM	500 ng	EUR 2966.4

UHRF1BP1L Protein Vector (Mouse) (pPB-N-His)
PV244095	ABM	500 ng	EUR 2966.4

UHRF1BP1L Protein Vector (Mouse) (pPM-C-HA)
PV244096	ABM	500 ng	EUR 2966.4

UHRF1BP1L Protein Vector (Mouse) (pPM-C-His)
PV244097	ABM	500 ng	EUR 2966.4

UHRF1BP1L Protein Vector (Rat) (pPB-C-His)
PV314458	ABM	500 ng	EUR 2985.6

UHRF1BP1L Protein Vector (Rat) (pPB-N-His)
PV314459	ABM	500 ng	EUR 2985.6

 

CHARMM: the biomolecular simulation program.

CHARMM (Chemistry at HARvard Molecular Mechanics) is a extraordinarily versatile and broadly used molecular simulation program.

It has been developed over the previous three a few years with a primary give consideration to molecules of natural curiosity, along with proteins, peptides, lipids, nucleic acids, carbohydrates, and small molecule ligands, as they occur in reply, crystals, and membrane environments.

For the look at of such methods, this method offers a giant suite of computational devices that embrace fairly just a few conformational and path sampling methods, free vitality estimators, molecular minimization, dynamics, and analysis strategies, and model-building capabilities.

The CHARMM program is related to points involving a a lot wider class of many-particle methods.

Calculations with CHARMM could also be carried out using numerous fully totally different vitality options and fashions, from blended quantum mechanical-molecular mechanical stress fields, to all-atom classical potential vitality options with particular solvent and quite a few boundary circumstances, to implicit solvent and membrane fashions.

This method has been ported to fairly just a few platforms in every serial and parallel architectures. This textual content offers an overview of this method as a result of it exists within the current day with an emphasis on developments as a result of the publication of the distinctive CHARMM article in 1983.

 

Ghrelin is a growth-hormone-releasing acylated peptide from stomach.

 

Small synthetic molecules often known as growth-hormone secretagogues (GHSs) stimulate the discharge of improvement hormone (GH) from the pituitary. They act by means of GHS-R, a G-protein-coupled receptor for which the ligand is unknown.

Present cloning of GHS-R strongly implies that an endogenous ligand for the receptor does exist and that there is a mechanism for regulating GH launch that is distinct from its regulation by hypothalamic growth-hormone-releasing hormone (GHRH).

 

We now report the purification and identification in rat stomach of an endogenous ligand explicit for GHS-R.

The purified ligand is a peptide of 28 amino acids, by which the serine three residue is n-octanoylated. The acylated peptide notably releases GH every in vivo and in vitro, and O-n-octanoylation at serine three is essential for the train.

We designate the GH-releasing peptide ‘ghrelin’ (ghre is the Proto-Indo-European root of the phrase ‘develop’). Human ghrelin is homologous to rat ghrelin apart from two amino acids.

The incidence of ghrelin in every rat and human signifies that GH launch from the pituitary may be regulated not solely by hypothalamic GHRH, however as well as by ghrelin.

Goat Anti-Mouse IgG Fc, 10MG
A008-10MG	Arbor Assays	10MG	EUR 321.6

Goat Anti-Rabbit IgG Fc, 10MG
A009-10MG	Arbor Assays	10MG	EUR 321.6

Anti-Inflammatory Peptide 1
5-00709	CHI Scientific	4 x 5mg	Ask for price

Anti-Inflammatory Peptide 1
A1008-10	ApexBio	10 mg	EUR 199.2
Description: Anti-Inflammatory Peptide 1 (C45H82N12O14S2), with the sequence H-Met-Gln-Met-Lys-Lys-Val-Leu-Asp-Ser-OH, belongs to the group of synthetic oligopeptides corresponding to a region of high amino-acid sequence similarity between uteroglobin and lipocortin I

Anti-Inflammatory Peptide 1
A1008-25	ApexBio	25 mg	EUR 254.4
Description: Anti-Inflammatory Peptide 1 (C45H82N12O14S2), with the sequence H-Met-Gln-Met-Lys-Lys-Val-Leu-Asp-Ser-OH, belongs to the group of synthetic oligopeptides corresponding to a region of high amino-acid sequence similarity between uteroglobin and lipocortin I

Anti-Inflammatory Peptide 1
A1008-5	ApexBio	5 mg	EUR 142.8
Description: Anti-Inflammatory Peptide 1 (C45H82N12O14S2), with the sequence H-Met-Gln-Met-Lys-Lys-Val-Leu-Asp-Ser-OH, belongs to the group of synthetic oligopeptides corresponding to a region of high amino-acid sequence similarity between uteroglobin and lipocortin I

Anti-Inflammatory Peptide 1
H-9435.0005	Bachem	5.0mg	EUR 327.6
Description: Sum Formula: C45H82N12O14S2; CAS# [118850-71-8]

Anti-Inflammatory Peptide 1
H-9435.0025	Bachem	25.0mg	EUR 1197.6
Description: Sum Formula: C45H82N12O14S2; CAS# [118850-71-8]

Doxorubicin HCl, 10mg
R2531-10mg	ACTGene	each	EUR 236.4

Donkey Anti-Sheep IgG (H&L), 10MG
A010-10MG	Arbor Assays	10MG	EUR 321.6

Recombinant other protein 1, Untagged, E.coli-10mg
QP13162-10mg	EnQuireBio	10mg	EUR 241.2

Recombinant other Alarelin Protein, Untagged, -10mg
QP10997-10mg	EnQuireBio	10mg	EUR 241.2

Anti-Inflammatory Peptide 2
5-00710	CHI Scientific	4 x 5mg	Ask for price

Anti-Inflammatory Peptide 3
5-00711	CHI Scientific	4 x 5mg	Ask for price

Anti-Inflammatory Peptide 2
H-9440.0005	Bachem	5.0mg	EUR 327.6
Description: Sum Formula: C46H77N13O15S; CAS# [118850-72-9]

Anti-Inflammatory Peptide 2
H-9440.0025	Bachem	25.0mg	EUR 1197.6
Description: Sum Formula: C46H77N13O15S; CAS# [118850-72-9]

Recombinant other protein 1, Untagged, E.coli-10mg
QP10853-EC-10mg	EnQuireBio	10mg	EUR 186

Recombinant Human GH1/ Growth hormone 1 Protein, Untagged, E.coli-10mg
QP5354-10mg	EnQuireBio	10mg	EUR 1491.6

Recombinant other Avidin Biotin Protein, Untagged, -10mg
QP10526-10mg	EnQuireBio	10mg	EUR 241.2

Recombinant Human CTRB1 Protein, Untagged, E.coli-10mg
QP10565-10mg	EnQuireBio	10mg	EUR 241.2

Recombinant Human Insulin Protein, Untagged, E.coli-10mg
QP10732-10mg	EnQuireBio	10mg	EUR 241.2

Recombinant other Lysostaphin Protein, Untagged, E.coli-10mg
QP10778-10mg	EnQuireBio	10mg	EUR 501.6

Recombinant Multi Species ACTH Protein, Untagged, -10mg
QP10950-10mg	EnQuireBio	10mg	EUR 241.2

Recombinant other Atosiban Protein, Untagged, E.coli-10mg
QP11102-10mg	EnQuireBio	10mg	EUR 186

Recombinant E.coli LACTB Protein, Untagged, E.coli-10mg
QP12522-10mg	EnQuireBio	10mg	EUR 1154.4

Recombinant other Lanreotide Protein, Untagged, E.coli-10mg
QP12536-10mg	EnQuireBio	10mg	EUR 675.6

Recombinant Human LHRH Protein, Untagged, E.coli-10mg
QP12569-10mg	EnQuireBio	10mg	EUR 186

Recombinant other SPA Protein, His, E.coli-10mg
QP13566-10mg	EnQuireBio	10mg	EUR 186

Recombinant other SST Protein, Untagged, E.coli-10mg
QP13598-10mg	EnQuireBio	10mg	EUR 241.2

Recombinant Rabbit TNC Protein, Untagged, Rabbit-10mg
QP13765-10mg	EnQuireBio	10mg	EUR 1273.2

Recombinant other Cetrorelix Protein, Untagged, E.coli-10mg
QP11394-10mg	EnQuireBio	10mg	EUR 1034.4

Recombinant Human EDN3 Protein, Untagged, E.coli-10mg
QP11747-10mg	EnQuireBio	10mg	EUR 2818.8

Recombinant other Exenatide Protein, Untagged, E.coli-10mg
QP11816-10mg	EnQuireBio	10mg	EUR 1154.4

Recombinant Human Leptin Protein, Untagged, E.coli-10mg
QP5350-10mg	EnQuireBio	10mg	EUR 610.8

Recombinant Mouse Leptin Protein, Untagged, E.coli-10mg
QP5429-10mg	EnQuireBio	10mg	EUR 1154.4

Recombinant Rat Leptin Protein, Untagged, E.coli-10mg
QP5507-10mg	EnQuireBio	10mg	EUR 1099.2

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 336

Recombinant other hCG Protein, Untagged, Native Protein-10mg
QP10664-10mg	EnQuireBio	10mg	EUR 294

Recombinant other Lipase A Protein, Untagged, E.coli-10mg
QP10772-10mg	EnQuireBio	10mg	EUR 186

Recombinant Human MG Protein, Untagged, Native Protein-10mg
QP10785-10mg	EnQuireBio	10mg	EUR 588

Recombinant Bovine Trypsin Protein, Untagged, Native Protein-10mg
QP10896-10mg	EnQuireBio	10mg	EUR 241.2

Recombinant Human UTI Protein, Untagged, Native Protein-10mg
QP10909-10mg	EnQuireBio	10mg	EUR 250.8

Recombinant Human A2M Protein, Untagged, Native Protein-10mg
QP10922-10mg	EnQuireBio	10mg	EUR 1948.8

Recombinant Human APOB Protein, Untagged, Native Protein-10mg
QP11047-10mg	EnQuireBio	10mg	EUR 5463.6

Recombinant Human B2M Protein, Untagged, Native Protein-10mg
QP11117-10mg	EnQuireBio	10mg	EUR 1698

Recombinant Human LDL Protein, Untagged, Native Protein-10mg
QP12550-10mg	EnQuireBio	10mg	EUR 195.6

Recombinant Human LTF Protein, Untagged, Native Protein-10mg
QP12595-10mg	EnQuireBio	10mg	EUR 5821.2

Recombinant Human LTF Holo Protein, Untagged, Rice-10mg
QP12596-10mg	EnQuireBio	10mg	EUR 186

Recombinant Human Myoglobin Protein, Untagged, Native Protein-10mg
QP12776-10mg	EnQuireBio	10mg	EUR 2470.8

Recombinant other Protein-L Protein, Untagged, E.coli-10mg
QP13168-10mg	EnQuireBio	10mg	EUR 241.2

Recombinant other SPA 33.4kDa Protein, Untagged, E.coli-10mg
QP13567-10mg	EnQuireBio	10mg	EUR 186

Recombinant other SPA Long Protein, Untagged, E.coli-10mg
QP13568-10mg	EnQuireBio	10mg	EUR 186

Recombinant other SPA-Cys Protein, Untagged, E.coli-10mg
QP13569-10mg	EnQuireBio	10mg	EUR 186

Recombinant other Streptavidin Protein, Untagged, Native Protein-10mg
QP13625-10mg	EnQuireBio	10mg	EUR 241.2

Recombinant Multi Species Trp Protein, Untagged, E.coli-10mg
QP13821-10mg	EnQuireBio	10mg	EUR 294

Recombinant Human C1q Protein, Untagged, Native Protein-10mg
QP11228-10mg	EnQuireBio	10mg	EUR 5463.6

Recombinant Human C3c Protein, Untagged, Native Protein-10mg
QP11238-10mg	EnQuireBio	10mg	EUR 1393.2

Recombinant Human C4c Protein, Untagged, Native Protein-10mg
QP11240-10mg	EnQuireBio	10mg	EUR 4267.2

Recombinant Human CKM Protein, Untagged, Native Protein-10mg
QP11436-10mg	EnQuireBio	10mg	EUR 5767.2

Recombinant Human CRP Protein, Untagged, Native Protein-10mg
QP11511-10mg	EnQuireBio	10mg	EUR 1099.2

Recombinant Human Ferritin Protein, Untagged, Native Protein-10mg
QP11867-10mg	EnQuireBio	10mg	EUR 2589.6

Recombinant Bovine Fibronectin Protein, Untagged, Native Protein-10mg
QP11880-10mg	EnQuireBio	10mg	EUR 1220.4

Recombinant Human Fibronectin Protein, Untagged, Native Protein-10mg
QP11881-10mg	EnQuireBio	10mg	EUR 1220.4

Recombinant Human Haptoglobin Protein, Untagged, Native Protein-10mg
QP12103-10mg	EnQuireBio	10mg	EUR 2350.8

Recombinant Human HbA1c Protein, Untagged, Native Protein-10mg
QP12117-10mg	EnQuireBio	10mg	EUR 2710.8

Recombinant Human HDL Protein, Untagged, Native Protein-10mg
QP12211-10mg	EnQuireBio	10mg	EUR 241.2

Recombinant other HSA Protein, Untagged, Pichia Pastoris-10mg
QP12314-10mg	EnQuireBio	10mg	EUR 186

Recombinant other HSA Recombinant Protein, Untagged, Rice-10mg
QP12317-10mg	EnQuireBio	10mg	EUR 195.6

Recombinant other Protein-A/G Protein, His, E.coli-10mg
QP13163-10mg	EnQuireBio	10mg	EUR 241.2

Recombinant other Protein-G His Protein, His, E.coli-10mg
QP13167-10mg	EnQuireBio	10mg	EUR 381.6

Recombinant other Protein-L Cys Protein, Untagged, E.coli-10mg
QP13169-10mg	EnQuireBio	10mg	EUR 241.2

Recombinant other SPA-Cys His Protein, His, E.coli-10mg
QP13570-10mg	EnQuireBio	10mg	EUR 186

Recombinant other SPA-Cys Long Protein, Untagged, E.coli-10mg
QP13571-10mg	EnQuireBio	10mg	EUR 186

Recombinant Human Collagen-III Protein, Untagged, Pichia Pastoris-10mg
QP11479-10mg	EnQuireBio	10mg	EUR 337.2

Recombinant other Cys-Protein-G Protein, Untagged, E.coli-10mg
QP11587-10mg	EnQuireBio	10mg	EUR 381.6

Recombinant other Cys-Protein-L Protein, Untagged, E.coli-10mg
QP11588-10mg	EnQuireBio	10mg	EUR 241.2

Recombinant other HSA Lipid free Protein, Untagged, Rice-10mg
QP12316-10mg	EnQuireBio	10mg	EUR 195.6

Anti-Kentsin Peptide
20-abx265748	Abbexa	EUR 393.60 EUR 594.00 EUR 326.40	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

Anti-Flt1 Peptide
20-abx265801	Abbexa	EUR 393.60 EUR 594.00 EUR 326.40	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

Recombinant other Protein Cys-A/G Protein, Untagged, E.coli-10mg
QP13161-10mg	EnQuireBio	10mg	EUR 241.2

Recombinant other Protein-A/G Cys Protein, Untagged, E.coli-10mg
QP13164-10mg	EnQuireBio	10mg	EUR 241.2

Recombinant other Protein-A/G/L Protein, Untagged, E.coli-10mg
QP13165-10mg	EnQuireBio	10mg	EUR 392.4

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 418.8

Recombinant other Protein-A/G/L-Cys Protein, Untagged, E.coli-10mg
QP13166-10mg	EnQuireBio	10mg	EUR 392.4

Recombinant other Cys-Protein-A/G/L Protein, Untagged, E.coli-10mg
QP11586-10mg	EnQuireBio	10mg	EUR 392.4

Hemokinin 1 Peptide
20-abx265072	Abbexa	EUR 594.00 EUR 978.00 EUR 427.20	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

Hemokinin 1 Peptide
20-abx265383	Abbexa	EUR 594.00 EUR 978.00 EUR 427.20	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

Achatin-1 Peptide
20-abx265822	Abbexa	EUR 410.40 EUR 627.60 EUR 326.40	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

Endomorphin-1 Peptide
20-abx265857	Abbexa	EUR 427.20 EUR 644.40 EUR 343.20	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

AF-1 Peptide
20-abx265891	Abbexa	EUR 427.20 EUR 644.40 EUR 343.20	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

WWamide-1 Peptide
20-abx265990	Abbexa	EUR 460.80 EUR 710.40 EUR 360.00	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

S6-1 Peptide
20-abx266162	Abbexa	EUR 526.80 EUR 861.60 EUR 393.60	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

KL-1 Peptide
20-abx266293	Abbexa	EUR 594.00 EUR 978.00 EUR 427.20	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

Alloferon 1 Peptide
20-abx266358	Abbexa	EUR 627.60 EUR 1045.20 EUR 460.80	10 mg 25 mg 5 mg
Shipped within 5-10 working days.