Awareness of bacterial traits and ability to avoid spreading infections.

A simple and short microbiology practical improves undergraduate nursing students' awareness of bacterial traits and ability to avoid spreading infections.

Nurses are accountable for implementing acceptable measures to scale back hospital infections, particularly with multidrug-resistant micro organism, in order that nursing college students ought to study microbiology. It helps them to grasp the unfold of micro organism and infectious illness management. Due to the tight schedule, nonetheless, restricted instructing in undergraduate nursing class in Japan.

ZBED2 Antibody

5121-002mg 0.02 mg
EUR 206.18
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: ZBED2 Antibody: The ZBED2 protein possesses a BED-type zinc finger, a 50 to 60 amino acid domain that contains a characteristic motif with two highly conserved aromatic positions, as well as a shared pattern of cysteines and histidines that is predicted to form the zinc finger. ZBED2 was identified through a screening of 37 human gastric cancer cDNA libraries. While the function of this protein unknown at this time, the presence of the zinc finger suggests that it may have DNA or RNA binding properties.

ZBED2 Antibody

5121-01mg 0.1 mg
EUR 523.7
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: ZBED2 Antibody: The ZBED2 protein possesses a BED-type zinc finger, a 50 to 60 amino acid domain that contains a characteristic motif with two highly conserved aromatic positions, as well as a shared pattern of cysteines and histidines that is predicted to form the zinc finger. ZBED2 was identified through a screening of 37 human gastric cancer cDNA libraries. While the function of this protein unknown at this time, the presence of the zinc finger suggests that it may have DNA or RNA binding properties.

ZBED2 Antibody

24873-100ul 100ul
EUR 468

ZBED2 siRNA

20-abx940156
  • EUR 661.20
  • EUR 878.40
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ZBED2

YF-PA20801 50 ul
EUR 435.6
Description: Mouse polyclonal to ZBED2

anti-ZBED2

YF-PA20802 50 ug
EUR 435.6
Description: Mouse polyclonal to ZBED2

ZBED2 cloning plasmid

CSB-CL880101HU-10ug 10ug
EUR 279.6
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atgaggcgggaagacgaggaagaggagggaacaatgatgaaggcaaaaggggacttagagatgaaggaggaggaagagattagtgagacaggagaactggttggcccttttgtgagtgctatgcccactccaatgccccacaacaagggcacccggttctctgaggcatgggaata
  • Show more
Description: A cloning plasmid for the ZBED2 gene.

Human ZBED2 shRNA Plasmid

20-abx962380
  • EUR 961.20
  • EUR 1345.20
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ZBED2 ELISA KIT

ELI-22405h 96 Tests
EUR 988.8

ZBED2 Recombinant Protein (Human)

RP035116 100 ug Ask for price

ZBED2 ORF Vector (Human) (pORF)

ORF011706 1.0 ug DNA
EUR 114

ZBED2 sgRNA CRISPR Lentivector set (Human)

K2659701 3 x 1.0 ug
EUR 406.8

ZBED2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2659702 1.0 ug DNA
EUR 184.8

ZBED2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2659703 1.0 ug DNA
EUR 184.8

ZBED2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2659704 1.0 ug DNA
EUR 184.8

ZBED2 Protein Vector (Human) (pPB-C-His)

PV046821 500 ng
EUR 394.8

ZBED2 Protein Vector (Human) (pPB-N-His)

PV046822 500 ng
EUR 394.8

ZBED2 Protein Vector (Human) (pPM-C-HA)

PV046823 500 ng
EUR 394.8

ZBED2 Protein Vector (Human) (pPM-C-His)

PV046824 500 ng
EUR 394.8

ZBED2 3'UTR GFP Stable Cell Line

TU078702 1.0 ml
EUR 1672.8

ZBED2 3'UTR Luciferase Stable Cell Line

TU028702 1.0 ml
EUR 1672.8

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-48T 48T
EUR 632.4
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-96T 96T
EUR 825.6
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-48T 48T
EUR 477.6
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-96T 96T
EUR 613.2
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-48T 48T
EUR 540
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-96T 96T
EUR 698.4
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-48T 48T
EUR 560.4
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-96T 96T
EUR 726
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

RD-C-Peptide-c-48Tests 48 Tests
EUR 639.6

Canine C-Peptide ELISA Kit

RD-C-Peptide-c-96Tests 96 Tests
EUR 888

Human C-Peptide ELISA Kit

RD-C-Peptide-Hu-48Tests 48 Tests
EUR 464.4

Human C-Peptide ELISA Kit

RD-C-Peptide-Hu-96Tests 96 Tests
EUR 638.4

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-48Tests 48 Tests
EUR 535.2

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-96Tests 96 Tests
EUR 738

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-48Tests 48 Tests
EUR 558

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-96Tests 96 Tests
EUR 771.6

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-48Tests 48 Tests
EUR 668.4

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-96Tests 96 Tests
EUR 928.8

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-48Tests 48 Tests
EUR 484.8

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-96Tests 96 Tests
EUR 667.2

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-48Tests 48 Tests
EUR 558

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-96Tests 96 Tests
EUR 771.6

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-48Tests 48 Tests
EUR 583.2

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-96Tests 96 Tests
EUR 806.4

ZBED2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2659705 3 x 1.0 ug
EUR 451.2

ZBED2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2659706 1.0 ug DNA
EUR 200.4

ZBED2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2659707 1.0 ug DNA
EUR 200.4

ZBED2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2659708 1.0 ug DNA
EUR 200.4

Human Connecting Peptide (C-Peptide) Peptide

abx670072-05mg 0.5 mg
EUR 678
  • Shipped within 1 week.

TKD Peptide (Hsp70 Peptide) (Hsp70 Peptide)

SIH-118A 1 mg
EUR 374.4
  • Hsp70 genes encode abundant heat-inducible 70-kDa hsps (hsp70s). In most eukaryotes hsp70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: The substance TKD Peptide (Hsp70 Peptide) is a hsp70 peptide. It is synthetically produced and has a purity of >98%. The pure substance is solid which is In aqueous solution.

Rat Connecting Peptide (C-Peptide) Peptide (OVA)

20-abx651058
  • EUR 510.00
  • EUR 276.00
  • EUR 1378.80
  • EUR 594.00
  • EUR 376.80
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TKD Peptide (Hsp70 Peptide): FITC (Hsp70 Peptide)

SIH-119A 1 mg
EUR 430.8
  • Hsp70 genes encode abundant heat-inducible 70-kDa hsps (hsp70s). In most eukaryotes hsp70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: The substance TKD Peptide (Hsp70 Peptide): FITC is a hsp70 peptide. It is synthetically produced and has a purity of >98%. The pure substance is solid which is In aqueous solution.

TKD Peptide (Hsp70 Peptide)

abx076809-1mg 1 mg
EUR 594
  • Shipped within 5-12 working days.

C-Peptide Blocking Peptide

3277BP-50 each
EUR 183.6

Connecting Peptide (C-Peptide) Antibody

20-abx100155
  • EUR 309.60
  • EUR 159.60
  • EUR 727.20
  • EUR 393.60
  • EUR 276.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Peptide YY (PYY) Peptide

20-abx068451
  • EUR 693.60
  • EUR 309.60
  • EUR 2013.60
  • EUR 811.20
  • EUR 510.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Peptide YY (PYY) Peptide

20-abx068452
  • EUR 710.40
  • EUR 309.60
  • EUR 2131.20
  • EUR 844.80
  • EUR 526.80
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Peptide YY (PYY) Peptide

20-abx068453
  • EUR 744.00
  • EUR 326.40
  • EUR 2230.80
  • EUR 878.40
  • EUR 543.60
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TKD Peptide (Hsp70 Peptide) (FITC)

abx076810-1mg 1 mg
EUR 678
  • Shipped within 5-12 working days.

Connecting Peptide (C-Peptide) Antibody

abx021134-100ug 100 ug
EUR 577.2
  • Shipped within 5-10 working days.

Connecting Peptide (C-Peptide) Antibody

abx021135-1mg 1 mg
EUR 886.8
  • Shipped within 5-10 working days.

Connecting Peptide (C-Peptide) Antibody

abx022864-01ml 0.1 ml
EUR 693.6
  • Shipped within 5-10 working days.

Connecting Peptide (C-peptide) Antibody

abx023812-1mg 1 mg
EUR 886.8
  • Shipped within 5-10 working days.

Connecting Peptide (C-Peptide) Antibody

abx414631-02mg 0.2 mg
EUR 678
  • Shipped within 1 week.

Connecting Peptide (C-Peptide) Antibody

abx414632-02mg 0.2 mg
EUR 678
  • Shipped within 1 week.

Connecting Peptide (C-Peptide) Antibody

abx414633-02mg 0.2 mg
EUR 678
  • Shipped within 1 week.

Connecting Peptide (C-Peptide) Antibody

abx414789-02mg 0.2 mg
EUR 678
  • Shipped within 1 week.

Connecting Peptide (C-Peptide) Antibody

abx414790-02mg 0.2 mg
EUR 678
  • Shipped within 1 week.

Connecting Peptide (C-Peptide) Antibody

abx411178-025mg 0.25 mg
EUR 678
  • Shipped within 1 week.

Formyl Peptide Receptor-like 2 Peptide

43-293P 0.1 mg
EUR 405.6

Human Glutaminyl Peptide Cyclotransferase (QPCT) Peptide

20-abx168154
  • EUR 794.40
  • EUR 326.40
  • EUR 2448.00
  • EUR 944.40
  • EUR 577.20
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cow Vasoactive Intestinal Peptide (VIP) Peptide

20-abx166274
  • EUR 777.60
  • EUR 326.40
  • EUR 2331.60
  • EUR 910.80
  • EUR 560.40
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cow Atrial Natriuretic Peptide (ANP) Peptide

20-abx166288
  • EUR 878.40
  • EUR 343.20
  • EUR 2766.00
  • EUR 1062.00
  • EUR 627.60
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Atrial Natriuretic Peptide (ANP) Peptide

20-abx065482
  • EUR 811.20
  • EUR 343.20
  • EUR 2498.40
  • EUR 961.20
  • EUR 577.20
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Atrial Natriuretic Peptide (ANP) Peptide

20-abx065483
  • EUR 693.60
  • EUR 309.60
  • EUR 2064.00
  • EUR 828.00
  • EUR 510.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Atrial Natriuretic Peptide (ANP) Peptide

20-abx065484
  • EUR 777.60
  • EUR 326.40
  • EUR 2331.60
  • EUR 910.80
  • EUR 560.40
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Atrial Natriuretic Peptide (ANP) Peptide

20-abx065486
  • EUR 777.60
  • EUR 326.40
  • EUR 2331.60
  • EUR 910.80
  • EUR 560.40
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Dog Brain Natriuretic Peptide (BNP) Peptide

20-abx065598
  • EUR 1062.00
  • EUR 393.60
  • EUR 3400.80
  • EUR 1262.40
  • EUR 727.20
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Brain Natriuretic Peptide (BNP) Peptide

20-abx065599
  • EUR 878.40
  • EUR 343.20
  • EUR 2766.00
  • EUR 1062.00
  • EUR 627.60
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Brain Natriuretic Peptide (BNP) Peptide

20-abx065600
  • EUR 895.20
  • EUR 360.00
  • EUR 2798.40
  • EUR 1062.00
  • EUR 627.60
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pig Brain Natriuretic Peptide (BNP) Peptide

20-abx065601
  • EUR 994.80
  • EUR 376.80
  • EUR 3199.20
  • EUR 1195.20
  • EUR 693.60
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Brain Natriuretic Peptide (BNP) Peptide

20-abx065602
  • EUR 895.20
  • EUR 360.00
  • EUR 2798.40
  • EUR 1062.00
  • EUR 627.60
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Cathelicidin Antimicrobial Peptide (CAMP) Peptide

20-abx065799
  • EUR 927.60
  • EUR 360.00
  • EUR 2932.80
  • EUR 1111.20
  • EUR 661.20
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Cathelicidin Antimicrobial Peptide (CAMP) Peptide

20-abx065800
  • EUR 844.80
  • EUR 343.20
  • EUR 2581.20
  • EUR 994.80
  • EUR 594.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Cathelicidin Antimicrobial Peptide (CAMP) Peptide

20-abx065801
  • EUR 895.20
  • EUR 343.20
  • EUR 2781.60
  • EUR 1062.00
  • EUR 627.60
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Vasoactive Intestinal Peptide (VIP) Peptide

20-abx069654
  • EUR 794.40
  • EUR 326.40
  • EUR 2448.00
  • EUR 944.40
  • EUR 577.20
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Vasoactive Intestinal Peptide (VIP) Peptide

20-abx069655
  • EUR 828.00
  • EUR 343.20
  • EUR 2548.80
  • EUR 978.00
  • EUR 594.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Vasoactive Intestinal Peptide (VIP) Peptide

20-abx069656
  • EUR 844.80
  • EUR 343.20
  • EUR 2598.00
  • EUR 994.80
  • EUR 594.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Connecting Peptide (C-Peptide) Antibody (Biotin)

abx021132-100ug 100 ug
EUR 693.6
  • Shipped within 5-10 working days.

Rat Galanin Like Peptide (GALP) Peptide

20-abx650475
  • EUR 777.60
  • EUR 326.40
  • EUR 2364.00
  • EUR 927.60
  • EUR 560.40
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Brain natriuretic peptide (BNP) Peptide

abx670010-01mg 0.1 mg
EUR 360
  • Shipped within 1 week.

Vasoactive Intestinal Peptide (VIP) Peptide (OVA)

20-abx651057
  • EUR 493.20
  • EUR 260.40
  • EUR 1296.00
  • EUR 560.40
  • EUR 360.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dog Peptide YY (PYY) Peptide (OVA)

20-abx651198
  • EUR 427.20
  • EUR 260.40
  • EUR 1178.40
  • EUR 526.80
  • EUR 343.20
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Peptide YY (PYY) Peptide (OVA)

20-abx651199
  • EUR 427.20
  • EUR 260.40
  • EUR 1178.40
  • EUR 526.80
  • EUR 343.20
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pig Peptide YY (PYY) Peptide (OVA)

20-abx651200
  • EUR 427.20
  • EUR 260.40
  • EUR 1178.40
  • EUR 526.80
  • EUR 343.20
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Peptide YY (PYY) Peptide (OVA)

20-abx651201
  • EUR 427.20
  • EUR 260.40
  • EUR 1178.40
  • EUR 526.80
  • EUR 343.20
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human C-Peptide (CP) Peptide (OVA)

20-abx651801
  • EUR 693.60
  • EUR 309.60
  • EUR 2064.00
  • EUR 828.00
  • EUR 510.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

 

Due to this fact, we examined whether or not easy quick sensible classes in microbiology class can assist increase consciousness of undergraduate nursing college students and find out how to forestall bacterial properties infections.

This research involving two courses of nursing college students (n = 76). Two quick sensible classes (a complete of three hours, in 2 days) was used to evaluate the effectiveness of hand washing or disinfection of micro organism in microbiology course of 16 courses (whole class time is 24 hours, plus check).

Micro organism which can be sampled on the LB arms in order that the plate with orientation through the first half day, and the plates are checked for colony with a distinct coloration or morphological traits, and mentioned, within the second session, one week later.

Questionnaires earlier than and after train that’s used to evaluate adjustments in consciousness invisible micro organism inhabit round us hyperlink the properties of micro organism and find out how to forestall infections.

The outcomes present that virtually increase consciousness of nursing college students from fomites (tools) (p = 0.0115) , fomites (contact-based) (p = 0.0016), habitat (physique floor) (p = 0.0127), the act of facilitating an infection in hospitals (p = 0.0166), and adjustments within the bodily situation brought on by an infection micro organism (p = 0.0136).

No change in phrase affiliation (p = 0.627) or habitat (within the physique) (p = 0.308). issue rating, which is a component within the questionnaire psychometric properties, have a tendency to be near the anticipated rating by way of sensible, however not statistically vital. As well as, no matter earlier than or after apply, rating Cronbach α, which is an indicator of the reliability of the multi-choice query objects, confirmed> 0.8, indicating the validity of the analysis objects.

Thus, the scholars’ consciousness invisible micro organism that inhabit round us elevated considerably in contrast with these earlier than the sensible microbiology quick class.the easy sensible successfully improve consciousness of nursing college students from the invisible micro organism inhabit round us within the technique of microbiology, helpful for even the tight instructing schedule.

 A simple and short microbiology practical improves undergraduate nursing students' awareness of bacterial traits and ability to avoid spreading infections.
A easy and quick microbiology sensible improves undergraduate nursing college students’ consciousness of bacterial traits and skill to keep away from spreading infections.

 

Assessing the affect of Medical Microbiology class utilizing an energetic technique within the short-term and long-term retention in medical college students: an progressive research.

One of many considerations of academics, with college students on the whole and the well being of the scholars specifically, is to make sure as a lot info from the scholar’s ongoing short-term reminiscences into long-term reminiscence. This research focuses on the retention of information in Medical Microbiology and assess the effectiveness of a number of methods which can be utilized to short-term and long-term retention.

A pre- and post-test was used to evaluate pupil studying. The research concerned college students from Porto College (the check group). all check group members attending the third 12 months of the Bachelor of Medication Program. The outcomes of post-test 1 is taken into account very optimistic and assist the significance of vigorous exercise is carried out and / or methodologies in Medical Microbiology for short-term retention.

Nevertheless, the outcomes obtained within the publish check 2 reveals that the retention of information after 9 months, though fairly massive, declined.

 

Rabbit Testoterone,T ELISA Kit

CN-00708R1 96T
EUR 520.8

Rabbit Testoterone,T ELISA Kit

CN-00708R2 48T
EUR 340.8

Canine Testoterone,T ELISA Kit

CN-00959C1 96T
EUR 564

Canine Testoterone,T ELISA Kit

CN-00959C2 48T
EUR 384

PoFAine Testoterone,T ELISA Kit

CN-01244P1 96T
EUR 529.2

PoFAine Testoterone,T ELISA Kit

CN-01244P2 48T
EUR 349.2

Human Testoterone,T ELISA Kit

CN-03934H1 96T
EUR 520.8

Human Testoterone,T ELISA Kit

CN-03934H2 48T
EUR 340.8

Rat Testoterone,T ELISA Kit

CN-01983R1 96T
EUR 536.4

Rat Testoterone,T ELISA Kit

CN-01983R2 48T
EUR 355.2

Rabbit Testoterone,T ELISA Kit

GA-E0201RB-48T 48T
EUR 391.2

Rabbit Testoterone,T ELISA Kit

GA-E0201RB-96T 96T
EUR 628.8

Rat Testoterone(T)ELISA Kit

GA-E0267RT-48T 48T
EUR 447.6

Rat Testoterone(T)ELISA Kit

GA-E0267RT-96T 96T
EUR 730.8

Human Testoterone,T ELISA Kit

201-12-1037 96 tests
EUR 528
  • This Testoterone ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Testoterone(T)ELISA Kit

GA-E1053HM-48T 48T
EUR 346.8

Human Testoterone(T)ELISA Kit

GA-E1053HM-96T 96T
EUR 559.2

Rat Testoterone(T)ELISA Kit

QY-E11385 96T
EUR 433.2

Human Testoterone (T) ELISA Kit

QY-E03353 96T
EUR 433.2

Rabbit Testoterone,T ELISA Kit

QY-E30098 96T
EUR 448.8

Canine Testoterone,T ELISA Kit

QY-E70064 96T
EUR 511.2

Mouse Testoterone ELISA Kit

EMT0499 96Tests
EUR 625.2

Mouse Testoterone recepter ELISA kit

E03T0534-192T 192 tests
EUR 1524
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Testoterone recepter ELISA kit

E03T0534-48 1 plate of 48 wells
EUR 624
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Testoterone recepter ELISA kit

E03T0534-96 1 plate of 96 wells
EUR 822
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Testosterone (T) ELISA Kit

DLR-T-Ge-48T 48T
EUR 562.8
  • Should the Testosterone (T) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Testosterone (T) in samples from serum, plasma, urine or other biological fluids.

Testosterone (T) ELISA Kit

DLR-T-Ge-96T 96T
EUR 729.6
  • Should the Testosterone (T) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Testosterone (T) in samples from serum, plasma, urine or other biological fluids.

Human Testoterone ELISA Kit

EHT0499 96Tests
EUR 625.2

Rat Testoterone ELISA Kit

ERT0499 96Tests
EUR 625.2

Canine Testoterone ELISA Kit

ELA-E0458d 96 Tests
EUR 1113.6

Human Testoterone ELISA Kit

ELA-E0458h 96 Tests
EUR 988.8

Porcine Testoterone ELISA Kit

ELA-E0458p 96 Tests
EUR 1113.6

Rat Testoterone ELISA Kit

ELA-E0458r 96 Tests
EUR 1063.2

Rabbit Testoterone ELISA Kit

ELA-E0458Rb 96 Tests
EUR 1113.6

General Testosterone (T) ELISA Kit

RD-T-Ge-48Tests 48 Tests
EUR 560.4

General Testosterone (T) ELISA Kit

RD-T-Ge-96Tests 96 Tests
EUR 775.2

General Testosterone (T) ELISA Kit

RDR-T-Ge-48Tests 48 Tests
EUR 585.6

General Testosterone (T) ELISA Kit

RDR-T-Ge-96Tests 96 Tests
EUR 811.2

Mouse Free Testoterone,F-TESTO ELISA Kit

CN-02853M1 96T
EUR 546

Mouse Free Testoterone,F-TESTO ELISA Kit

CN-02853M2 48T
EUR 364.8

Mouse Free Testoterone(F-TESTO)ELISA Kit    

GA-E0274MS-48T 48T
EUR 403.2

Mouse Free Testoterone(F-TESTO)ELISA Kit    

GA-E0274MS-96T 96T
EUR 640.8

Mouse Free Testoterone(F-TESTO)ELISA Kit

QY-E20613 96T
EUR 433.2

Human Testoterone recepter ELISA kit

E01T0534-192T 192 tests
EUR 1524
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Testoterone recepter ELISA kit

E01T0534-48 1 plate of 48 wells
EUR 624
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Testoterone recepter ELISA kit

E01T0534-96 1 plate of 96 wells
EUR 822
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Testoterone recepter ELISA kit

E04T0534-192T 192 tests
EUR 1524
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Testoterone recepter ELISA kit

E04T0534-48 1 plate of 48 wells
EUR 624
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Testoterone recepter ELISA kit

E04T0534-96 1 plate of 96 wells
EUR 822
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Testoterone recepter ELISA kit

E06T0534-192T 192 tests
EUR 1524
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Testoterone recepter ELISA kit

E06T0534-48 1 plate of 48 wells
EUR 624
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Testoterone recepter ELISA kit

E06T0534-96 1 plate of 96 wells
EUR 822
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Testoterone recepter ELISA kit

E08T0534-192T 192 tests
EUR 1524
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Testoterone recepter ELISA kit

E08T0534-48 1 plate of 48 wells
EUR 624
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Testoterone recepter ELISA kit

E08T0534-96 1 plate of 96 wells
EUR 822
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Testoterone recepter ELISA kit

E07T0534-192T 192 tests
EUR 1524
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Testoterone recepter ELISA kit

E07T0534-48 1 plate of 48 wells
EUR 624
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Testoterone recepter ELISA kit

E07T0534-96 1 plate of 96 wells
EUR 822
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Testoterone recepter ELISA kit

E02T0534-192T 192 tests
EUR 1524
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Testoterone recepter ELISA kit

E02T0534-48 1 plate of 48 wells
EUR 624
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Testoterone recepter ELISA kit

E02T0534-96 1 plate of 96 wells
EUR 822
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Testoterone recepter ELISA kit

E09T0534-192T 192 tests
EUR 1524
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Testoterone recepter ELISA kit

E09T0534-48 1 plate of 48 wells
EUR 624
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Testoterone recepter ELISA kit

E09T0534-96 1 plate of 96 wells
EUR 822
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Testoterone recepter ELISA Kit

ELA-E1836h 96 Tests
EUR 988.8

Human Free Testoterone ELISA Kit

ELA-E0457h 96 Tests
EUR 988.8

Neutral field screens

ELE7548 EACH
EUR 69.54

F-TESTO ELISA Kit| Mouse Free Testoterone ELISA Kit

EF013609 96 Tests
EUR 826.8

T-Pro BCA Protein Assay kit

JB04-D001 500assay/KIT
EUR 244.8

T-Pro Plasmid Mini Kit (100)

RB94-YPD100 100preps/Kit
EUR 193.2

T-Pro Plasmid Mini Kit (250)

RB94-YPD250 250preps/Kit
EUR 266.4

T-Pro Plasmid Midi Kit (20)

RB94-YPI020 20preps/Kit
EUR 255.6

T-Pro Plasmid Maxi Kit (10)

RB94-YPM010 10preps/Kit
EUR 266.4

T-Pro Bradford Protein Assay kit(1X)

JB04-D002 500ml/BT
EUR 193.2

T-Pro Genomic DNA Midi Kit (20)

RB94-NGM020 20preps/kit
EUR 266.4

T-Pro Genomic DNA Mini Kit (100)

RB94-NGS100 100preps/kit
EUR 255.6

Guinea pig Testoterone recepter ELISA kit

E05T0534-192T 192 tests
EUR 1524
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Testoterone recepter ELISA kit

E05T0534-48 1 plate of 48 wells
EUR 624
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Testoterone recepter ELISA kit

E05T0534-96 1 plate of 96 wells
EUR 822
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Testoterone recepter,TR ELISA Kit

201-12-1855 96 tests
EUR 528
  • This Testoterone recepter ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Testoterone recepter(TR)ELISA Kit

GA-E1871HM-48T 48T
EUR 346.8

Human Testoterone recepter(TR)ELISA Kit

GA-E1871HM-96T 96T
EUR 559.2

Human Testoterone recepter(TR)ELISA Kit

QY-E03352 96T
EUR 433.2

T-Pro LumiFast Plus Chemiluminescence Detection Kit (ECL Kit)

JT96-K002M 250ml*2/Kit
EUR 244.8

T-Pro LumiFast Plus Chemiluminescence Detection Kit (ECL Kit)

JT96-K002S 100ml*2/Kit
EUR 182.4

T-Pro LumiLong Plus Chemiluminescence Detection Kit (ECL Kit)

JT96-K004M 250ml*2/Kit
EUR 286.8

T-Pro LumiLong Plus Chemiluminescence Detection Kit (ECL Kit)

JT96-K004S 100ml*2/Kit
EUR 204

T-Pro Stacking Buffer

JB03-C002 500ml/BT
EUR 182.4

T-Pro MycoClean spray

JT90-R002 500ml/BT
EUR 172.8

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 242.4

T-Pro Endotoxin Removal Plasmid Midi kit (25)

RB94-EPI020 20preps/Kit
EUR 297.6

T-Pro Endotoxin Removal Plasmid Maxi kit (10)

RB94-EPM010 10preps/Kit
EUR 318

Leave A Comment