Awareness of bacterial traits and ability to avoid spreading infections.

A simple and short microbiology practical improves undergraduate nursing students' awareness of bacterial traits and ability to avoid spreading infections.

Nurses are accountable for implementing acceptable measures to scale back hospital infections, particularly with multidrug-resistant micro organism, in order that nursing college students ought to study microbiology. It helps them to grasp the unfold of micro organism and infectious illness management. Due to the tight schedule, nonetheless, restricted instructing in undergraduate nursing class in Japan.

ZBED2 siRNA

20-abx940156
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ZBED2

YF-PA20801 50 ul
EUR 363.00
Description: Mouse polyclonal to ZBED2

anti-ZBED2

YF-PA20802 50 ug
EUR 363.00
Description: Mouse polyclonal to ZBED2

ZBED2 cloning plasmid

CSB-CL880101HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atgaggcgggaagacgaggaagaggagggaacaatgatgaaggcaaaaggggacttagagatgaaggaggaggaagagattagtgagacaggagaactggttggcccttttgtgagtgctatgcccactccaatgccccacaacaagggcacccggttctctgaggcatgggaata
  • Show more
Description: A cloning plasmid for the ZBED2 gene.

Human ZBED2 shRNA Plasmid

20-abx962380
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ZBED2 ELISA KIT

ELI-22405h 96 Tests
EUR 824.00

ZBED2 Recombinant Protein (Human)

RP035116 100 ug Ask for price

ZBED2 ORF Vector (Human) (pORF)

ORF011706 1.0 ug DNA
EUR 95.00

ZBED2 sgRNA CRISPR Lentivector set (Human)

K2659701 3 x 1.0 ug
EUR 339.00

ZBED2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2659702 1.0 ug DNA
EUR 154.00

ZBED2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2659703 1.0 ug DNA
EUR 154.00

ZBED2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2659704 1.0 ug DNA
EUR 154.00

ZBED2 Protein Vector (Human) (pPB-C-His)

PV046821 500 ng
EUR 329.00

ZBED2 Protein Vector (Human) (pPB-N-His)

PV046822 500 ng
EUR 329.00

ZBED2 Protein Vector (Human) (pPM-C-HA)

PV046823 500 ng
EUR 329.00

ZBED2 Protein Vector (Human) (pPM-C-His)

PV046824 500 ng
EUR 329.00

ZBED2 3'UTR Luciferase Stable Cell Line

TU028702 1.0 ml
EUR 1394.00

ZBED2 3'UTR GFP Stable Cell Line

TU078702 1.0 ml
EUR 1394.00

Canine C-Peptide ELISA Kit

DL-C-Peptide-c-192 1 kit of 192 tests
EUR 1180.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Canine C-Peptide

Canine C-Peptide ELISA Kit

DL-C-Peptide-c-48 1 kit of 48 tests
EUR 492.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Canine C-Peptide

Canine C-Peptide ELISA Kit

DL-C-Peptide-c-96 1 kit of 96 tests
EUR 660.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Canine C-Peptide

Human C-Peptide ELISA Kit

DL-C-Peptide-Hu-192 1 kit of 192 tests
EUR 842.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Human C-Peptide

Human C-Peptide ELISA Kit

DL-C-Peptide-Hu-48 1 kit of 48 tests
EUR 374.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Human C-Peptide

Human C-Peptide ELISA Kit

DL-C-Peptide-Hu-96 1 kit of 96 tests
EUR 491.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Human C-Peptide

Mouse C-Peptide ELISA Kit

DL-C-Peptide-Mu-192 1 kit of 192 tests
EUR 978.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Mouse C-Peptide

Mouse C-Peptide ELISA Kit

DL-C-Peptide-Mu-48 1 kit of 48 tests
EUR 421.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Mouse C-Peptide

Mouse C-Peptide ELISA Kit

DL-C-Peptide-Mu-96 1 kit of 96 tests
EUR 559.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Mouse C-Peptide

Rat C-Peptide ELISA Kit

DL-C-Peptide-Ra-192 1 kit of 192 tests
EUR 1023.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Rat C-Peptide

Rat C-Peptide ELISA Kit

DL-C-Peptide-Ra-48 1 kit of 48 tests
EUR 437.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Rat C-Peptide

Rat C-Peptide ELISA Kit

DL-C-Peptide-Ra-96 1 kit of 96 tests
EUR 581.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Rat C-Peptide

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-48T 48T
EUR 527.00
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-96T 96T
EUR 688.00
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-48T 48T
EUR 398.00
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-96T 96T
EUR 511.00
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-48T 48T
EUR 450.00
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-96T 96T
EUR 582.00
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-48T 48T
EUR 467.00
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-96T 96T
EUR 605.00
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-48Tests 48 Tests
EUR 557.00

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-96Tests 96 Tests
EUR 774.00

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-48Tests 48 Tests
EUR 404.00

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-96Tests 96 Tests
EUR 556.00

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-48Tests 48 Tests
EUR 465.00

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-96Tests 96 Tests
EUR 643.00

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-48Tests 48 Tests
EUR 486.00

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-96Tests 96 Tests
EUR 672.00

Canine C-Peptide ELISA Kit

RD-C-Peptide-c-48Tests 48 Tests
EUR 533.00

Canine C-Peptide ELISA Kit

RD-C-Peptide-c-96Tests 96 Tests
EUR 740.00

Human C-Peptide ELISA Kit

RD-C-Peptide-Hu-48Tests 48 Tests
EUR 387.00

Human C-Peptide ELISA Kit

RD-C-Peptide-Hu-96Tests 96 Tests
EUR 532.00

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-48Tests 48 Tests
EUR 446.00

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-96Tests 96 Tests
EUR 615.00

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-48Tests 48 Tests
EUR 465.00

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-96Tests 96 Tests
EUR 643.00

ZBED2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2659705 3 x 1.0 ug
EUR 376.00

ZBED2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2659706 1.0 ug DNA
EUR 167.00

ZBED2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2659707 1.0 ug DNA
EUR 167.00

ZBED2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2659708 1.0 ug DNA
EUR 167.00

Human Connecting Peptide (C-Peptide) Peptide

abx670072-05mg 0.5 mg
EUR 565.00
  • Shipped within 1 week.

TKD Peptide (Hsp70 Peptide) (Hsp70 Peptide)

SIH-118A 1 mg
EUR 312.00
  • Hsp70 genes encode abundant heat-inducible 70-kDa hsps (hsp70s). In most eukaryotes hsp70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: The substance TKD Peptide (Hsp70 Peptide) is a hsp70 peptide. It is synthetically produced and has a purity of >98%. The pure substance is solid which is In aqueous solution.

Rat Connecting Peptide (C-Peptide) Peptide (OVA)

20-abx651058
  • EUR 425.00
  • EUR 230.00
  • EUR 1149.00
  • EUR 495.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TKD Peptide (Hsp70 Peptide): FITC (Hsp70 Peptide)

SIH-119A 1 mg
EUR 359.00
  • Hsp70 genes encode abundant heat-inducible 70-kDa hsps (hsp70s). In most eukaryotes hsp70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: The substance TKD Peptide (Hsp70 Peptide): FITC is a hsp70 peptide. It is synthetically produced and has a purity of >98%. The pure substance is solid which is In aqueous solution.

TKD Peptide (Hsp70 Peptide)

abx076809-1mg 1 mg
EUR 495.00
  • Shipped within 5-12 working days.

C-Peptide Blocking Peptide

3277BP-50
EUR 153.00

TKD Peptide (Hsp70 Peptide) (FITC)

abx076810-1mg 1 mg
EUR 565.00
  • Shipped within 5-12 working days.

Human Peptide YY (PYY) Peptide

20-abx068451
  • EUR 578.00
  • EUR 258.00
  • EUR 1678.00
  • EUR 676.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Peptide YY (PYY) Peptide

20-abx068452
  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Peptide YY (PYY) Peptide

20-abx068453
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Connecting Peptide (C-Peptide) Antibody

20-abx100155
  • EUR 258.00
  • EUR 133.00
  • EUR 606.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Connecting Peptide (C-Peptide) Antibody

abx021134-100ug 100 ug
EUR 481.00
  • Shipped within 5-10 working days.

Connecting Peptide (C-Peptide) Antibody

abx021135-1mg 1 mg
EUR 739.00
  • Shipped within 5-10 working days.

Connecting Peptide (C-Peptide) Antibody

abx022864-01ml 0.1 ml
EUR 578.00
  • Shipped within 5-10 working days.

Connecting Peptide (C-peptide) Antibody

abx023812-1mg 1 mg
EUR 739.00
  • Shipped within 5-10 working days.

Connecting Peptide (C-Peptide) Antibody

abx411178-025mg 0.25 mg
EUR 565.00
  • Shipped within 1 week.

Connecting Peptide (C-Peptide) Antibody

abx414631-02mg 0.2 mg
EUR 565.00
  • Shipped within 1 week.

Connecting Peptide (C-Peptide) Antibody

abx414632-02mg 0.2 mg
EUR 565.00
  • Shipped within 1 week.

Connecting Peptide (C-Peptide) Antibody

abx414633-02mg 0.2 mg
EUR 565.00
  • Shipped within 1 week.

Connecting Peptide (C-Peptide) Antibody

abx414789-02mg 0.2 mg
EUR 565.00
  • Shipped within 1 week.

Connecting Peptide (C-Peptide) Antibody

abx414790-02mg 0.2 mg
EUR 565.00
  • Shipped within 1 week.

Cow Vasoactive Intestinal Peptide (VIP) Peptide

20-abx166274
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cow Atrial Natriuretic Peptide (ANP) Peptide

20-abx166288
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Glutaminyl Peptide Cyclotransferase (QPCT) Peptide

20-abx168154
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Vasoactive Intestinal Peptide (VIP) Peptide

20-abx069654
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Vasoactive Intestinal Peptide (VIP) Peptide

20-abx069655
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Vasoactive Intestinal Peptide (VIP) Peptide

20-abx069656
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Atrial Natriuretic Peptide (ANP) Peptide

20-abx065482
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Atrial Natriuretic Peptide (ANP) Peptide

20-abx065483
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Atrial Natriuretic Peptide (ANP) Peptide

20-abx065484
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Atrial Natriuretic Peptide (ANP) Peptide

20-abx065486
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Dog Brain Natriuretic Peptide (BNP) Peptide

20-abx065598
  • EUR 885.00
  • EUR 328.00
  • EUR 2834.00
  • EUR 1052.00
  • EUR 606.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Brain Natriuretic Peptide (BNP) Peptide

20-abx065599
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Brain Natriuretic Peptide (BNP) Peptide

20-abx065600
  • EUR 746.00
  • EUR 300.00
  • EUR 2332.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pig Brain Natriuretic Peptide (BNP) Peptide

20-abx065601
  • EUR 829.00
  • EUR 314.00
  • EUR 2666.00
  • EUR 996.00
  • EUR 578.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Brain Natriuretic Peptide (BNP) Peptide

20-abx065602
  • EUR 746.00
  • EUR 300.00
  • EUR 2332.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Cathelicidin Antimicrobial Peptide (CAMP) Peptide

20-abx065799
  • EUR 773.00
  • EUR 300.00
  • EUR 2444.00
  • EUR 926.00
  • EUR 551.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Cathelicidin Antimicrobial Peptide (CAMP) Peptide

20-abx065800
  • EUR 704.00
  • EUR 286.00
  • EUR 2151.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Cathelicidin Antimicrobial Peptide (CAMP) Peptide

20-abx065801
  • EUR 746.00
  • EUR 286.00
  • EUR 2318.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Connecting Peptide (C-Peptide) Antibody (Biotin)

abx021132-100ug 100 ug
EUR 578.00
  • Shipped within 5-10 working days.

 

Due to this fact, we examined whether or not easy quick sensible classes in microbiology class can assist increase consciousness of undergraduate nursing college students and find out how to forestall bacterial properties infections.

This research involving two courses of nursing college students (n = 76). Two quick sensible classes (a complete of three hours, in 2 days) was used to evaluate the effectiveness of hand washing or disinfection of micro organism in microbiology course of 16 courses (whole class time is 24 hours, plus check).

Micro organism which can be sampled on the LB arms in order that the plate with orientation through the first half day, and the plates are checked for colony with a distinct coloration or morphological traits, and mentioned, within the second session, one week later.

Questionnaires earlier than and after train that’s used to evaluate adjustments in consciousness invisible micro organism inhabit round us hyperlink the properties of micro organism and find out how to forestall infections.

The outcomes present that virtually increase consciousness of nursing college students from fomites (tools) (p = 0.0115) , fomites (contact-based) (p = 0.0016), habitat (physique floor) (p = 0.0127), the act of facilitating an infection in hospitals (p = 0.0166), and adjustments within the bodily situation brought on by an infection micro organism (p = 0.0136).

No change in phrase affiliation (p = 0.627) or habitat (within the physique) (p = 0.308). issue rating, which is a component within the questionnaire psychometric properties, have a tendency to be near the anticipated rating by way of sensible, however not statistically vital. As well as, no matter earlier than or after apply, rating Cronbach α, which is an indicator of the reliability of the multi-choice query objects, confirmed> 0.8, indicating the validity of the analysis objects.

Thus, the scholars’ consciousness invisible micro organism that inhabit round us elevated considerably in contrast with these earlier than the sensible microbiology quick class.the easy sensible successfully improve consciousness of nursing college students from the invisible micro organism inhabit round us within the technique of microbiology, helpful for even the tight instructing schedule.

 A simple and short microbiology practical improves undergraduate nursing students' awareness of bacterial traits and ability to avoid spreading infections.
A easy and quick microbiology sensible improves undergraduate nursing college students’ consciousness of bacterial traits and skill to keep away from spreading infections.

 

Assessing the affect of Medical Microbiology class utilizing an energetic technique within the short-term and long-term retention in medical college students: an progressive research.

One of many considerations of academics, with college students on the whole and the well being of the scholars specifically, is to make sure as a lot info from the scholar’s ongoing short-term reminiscences into long-term reminiscence. This research focuses on the retention of information in Medical Microbiology and assess the effectiveness of a number of methods which can be utilized to short-term and long-term retention.

A pre- and post-test was used to evaluate pupil studying. The research concerned college students from Porto College (the check group). all check group members attending the third 12 months of the Bachelor of Medication Program. The outcomes of post-test 1 is taken into account very optimistic and assist the significance of vigorous exercise is carried out and / or methodologies in Medical Microbiology for short-term retention.

Nevertheless, the outcomes obtained within the publish check 2 reveals that the retention of information after 9 months, though fairly massive, declined.

 

Rabbit Testoterone,T ELISA Kit

CN-00708R1 96T
EUR 434.00

Rabbit Testoterone,T ELISA Kit

CN-00708R2 48T
EUR 284.00

Canine Testoterone,T ELISA Kit

CN-00959C1 96T
EUR 470.00

Canine Testoterone,T ELISA Kit

CN-00959C2 48T
EUR 320.00

PoFAine Testoterone,T ELISA Kit

CN-01244P1 96T
EUR 441.00

PoFAine Testoterone,T ELISA Kit

CN-01244P2 48T
EUR 291.00

Rat Testoterone,T ELISA Kit

CN-01983R1 96T
EUR 447.00

Rat Testoterone,T ELISA Kit

CN-01983R2 48T
EUR 296.00

Human Testoterone,T ELISA Kit

CN-03934H1 96T
EUR 434.00

Human Testoterone,T ELISA Kit

CN-03934H2 48T
EUR 284.00

Human Testoterone,T ELISA Kit

201-12-1037 96 tests
EUR 440.00
  • This Testoterone ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Testoterone(T)ELISA Kit

GA-E1053HM-48T 48T
EUR 289.00

Human Testoterone(T)ELISA Kit

GA-E1053HM-96T 96T
EUR 466.00

Rabbit Testoterone,T ELISA Kit

GA-E0201RB-48T 48T
EUR 326.00

Rabbit Testoterone,T ELISA Kit

GA-E0201RB-96T 96T
EUR 524.00

Rat Testoterone(T)ELISA Kit

GA-E0267RT-48T 48T
EUR 373.00

Rat Testoterone(T)ELISA Kit

GA-E0267RT-96T 96T
EUR 609.00

Human Testoterone (T) ELISA Kit

QY-E03353 96T
EUR 361.00

Rat Testoterone(T)ELISA Kit

QY-E11385 96T
EUR 361.00

Rabbit Testoterone,T ELISA Kit

QY-E30098 96T
EUR 374.00

Canine Testoterone,T ELISA Kit

QY-E70064 96T
EUR 426.00

Mouse Testoterone ELISA Kit

EMT0499 96Tests
EUR 521.00

Mouse Testoterone recepter ELISA kit

E03T0534-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Testoterone recepter ELISA kit

E03T0534-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Testoterone recepter ELISA kit

E03T0534-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Testosterone (T) ELISA Kit

DLR-T-Ge-48T 48T
EUR 469.00
  • Should the Testosterone (T) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Testosterone (T) in samples from serum, plasma, urine or other biological fluids.

Testosterone (T) ELISA Kit

DLR-T-Ge-96T 96T
EUR 608.00
  • Should the Testosterone (T) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Testosterone (T) in samples from serum, plasma, urine or other biological fluids.

Testosterone (T) ELISA Kit

DL-T-Ge-192 1 kit of 192 tests
EUR 1028.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Testosterone (T)

Testosterone (T) ELISA Kit

DL-T-Ge-48 1 kit of 48 tests
EUR 439.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Testosterone (T)

Testosterone (T) ELISA Kit

DL-T-Ge-96 1 kit of 96 tests
EUR 584.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Testosterone (T)

Rat Testoterone ELISA Kit

ERT0499 96Tests
EUR 521.00

Human Testoterone ELISA Kit

EHT0499 96Tests
EUR 521.00

Canine Testoterone ELISA Kit

ELA-E0458d 96 Tests
EUR 928.00

Human Testoterone ELISA Kit

ELA-E0458h 96 Tests
EUR 824.00

Porcine Testoterone ELISA Kit

ELA-E0458p 96 Tests
EUR 928.00

Rat Testoterone ELISA Kit

ELA-E0458r 96 Tests
EUR 886.00

Rabbit Testoterone ELISA Kit

ELA-E0458Rb 96 Tests
EUR 928.00

General Testosterone (T) ELISA Kit

RD-T-Ge-48Tests 48 Tests
EUR 467.00

General Testosterone (T) ELISA Kit

RD-T-Ge-96Tests 96 Tests
EUR 646.00

General Testosterone (T) ELISA Kit

RDR-T-Ge-48Tests 48 Tests
EUR 488.00

General Testosterone (T) ELISA Kit

RDR-T-Ge-96Tests 96 Tests
EUR 676.00

T-Pro BCA Protein Assay kit

JB04-D001 500assay/KIT
EUR 204.00

T-Pro Plasmid Mini Kit (100)

RB94-YPD100 100preps/Kit
EUR 161.00

T-Pro Plasmid Mini Kit (250)

RB94-YPD250 250preps/Kit
EUR 222.00

T-Pro Plasmid Midi Kit (20)

RB94-YPI020 20preps/Kit
EUR 213.00

T-Pro Plasmid Maxi Kit (10)

RB94-YPM010 10preps/Kit
EUR 222.00

Mouse Free Testoterone,F-TESTO ELISA Kit

CN-02853M1 96T
EUR 455.00

Mouse Free Testoterone,F-TESTO ELISA Kit

CN-02853M2 48T
EUR 304.00

Mouse Free Testoterone(F-TESTO)ELISA Kit    

GA-E0274MS-48T 48T
EUR 336.00

Mouse Free Testoterone(F-TESTO)ELISA Kit    

GA-E0274MS-96T 96T
EUR 534.00

Mouse Free Testoterone(F-TESTO)ELISA Kit

QY-E20613 96T
EUR 361.00

Monkey Testoterone recepter ELISA kit

E09T0534-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Testoterone recepter ELISA kit

E09T0534-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Testoterone recepter ELISA kit

E09T0534-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Testoterone recepter ELISA Kit

ELA-E1836h 96 Tests
EUR 824.00

Human Free Testoterone ELISA Kit

ELA-E0457h 96 Tests
EUR 824.00

Dog Testoterone recepter ELISA kit

E08T0534-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Testoterone recepter ELISA kit

E08T0534-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Testoterone recepter ELISA kit

E08T0534-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Testoterone recepter ELISA kit

E01T0534-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Testoterone recepter ELISA kit

E01T0534-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Testoterone recepter ELISA kit

E01T0534-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Testoterone recepter ELISA kit

E06T0534-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Testoterone recepter ELISA kit

E06T0534-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Testoterone recepter ELISA kit

E06T0534-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Testoterone recepter ELISA kit

E04T0534-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Testoterone recepter ELISA kit

E04T0534-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Testoterone recepter ELISA kit

E04T0534-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Testoterone recepter ELISA kit

E07T0534-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Testoterone recepter ELISA kit

E07T0534-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Testoterone recepter ELISA kit

E07T0534-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Testoterone recepter ELISA kit

E02T0534-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Testoterone recepter ELISA kit

E02T0534-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Testoterone recepter ELISA kit

E02T0534-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Testoterone recepter in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

long bridge. migration field 8.5 cm.

EHCA1200-BR11B03 ea
EUR 60.00

long bridge. migration field 11 cm.

EHCA1200-BR11B04 ea
EUR 60.00

F-TESTO ELISA Kit| Mouse Free Testoterone ELISA Kit

EF013609 96 Tests
EUR 689.00

T-Pro Bradford Protein Assay kit(1X)

JB04-D002 500ml/BT
EUR 161.00

T-Pro Genomic DNA Midi Kit (20)

RB94-NGM020 20preps/kit
EUR 222.00

T-Pro Genomic DNA Mini Kit (100)

RB94-NGS100 100preps/kit
EUR 213.00

T-Pro LumiFast Plus Chemiluminescence Detection Kit (ECL Kit)

JT96-K002M 250ml*2/Kit
EUR 204.00

T-Pro LumiFast Plus Chemiluminescence Detection Kit (ECL Kit)

JT96-K002S 100ml*2/Kit
EUR 152.00

T-Pro LumiLong Plus Chemiluminescence Detection Kit (ECL Kit)

JT96-K004M 250ml*2/Kit
EUR 239.00

T-Pro LumiLong Plus Chemiluminescence Detection Kit (ECL Kit)

JT96-K004S 100ml*2/Kit
EUR 170.00

T-Pro Stacking Buffer

JB03-C002 500ml/BT
EUR 152.00

T-Pro MycoClean spray

JT90-R002 500ml/BT
EUR 144.00

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202.00

T-Pro Endotoxin Removal Plasmid Midi kit (25)

RB94-EPI020 20preps/Kit
EUR 248.00

T-Pro Endotoxin Removal Plasmid Maxi kit (10)

RB94-EPM010 10preps/Kit
EUR 265.00

T-Pro Plant Genomic DNA Midi Kit (20)

RB94-PGM020 20preps/kit
EUR 222.00

T-Pro Plant Genomic DNA Mini Kit (100)

RB94-PGS100 100preps/kit
EUR 222.00

Human Testoterone recepter,TR ELISA Kit

201-12-1855 96 tests
EUR 440.00
  • This Testoterone recepter ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Leave A Comment